4E fe: Двигатель Toyota 4E-FE: характеристики, описание, куда установлен

Содержание

Двигатель Toyota 4E-FE: характеристики, описание, куда установлен

Toyota 4E-FE – 4-цилиндровый 16-клапанный двигатель японского производства. Рабочий объем данного мотора составляет 1,3 литра. Топливо – бензин (АИ-92, АИ-95). Двигатель выпускался с 1989 по 1999 год.

Двигатель Toyota 4E-FE

Для мотора был подобран 5-опорный коленчатый вал со специальными противовесами для разгрузки подшипников. На этапе сборки в вале проделываются отверстия для подвода масла к трущимся элементам конструкции. Для головки блока цилиндров используется алюминий. Размещение свечей зажигания происходит во внутренней полости цилиндров. Коленчатый вал через ремень ГРМ приводит в действие распределительный вал. Замена ремня грм 4E-FE обязательна при прохождении 70-80 тыс. км пробега. Блок цилиндров изготовлен из чугуна.

Поколения 4E-FE

Поколение123
Года выпуска1989-199619941997-1999
Объем1,3 литра
Мощность88 л.с.74 л.с82-85 л.с.
Крутящий момент117 Н*м при 5200 оборотах в минуту118 Н*м при 4400 оборотах в минуту
Степень сжатия9.6:19.6:1
Диаметр цилиндра74 мм74.3 мм
Ход поршня77.4 мм77.4 мм

Двигатели 4E-FE первого поколения производились с 1989 по 1996 год. Они устанавливались в модели Toyota Starlet и Corolla. Их максимальная мощность доходила до 88 л.с. при 6600 об/мин и 117 Н/м при 5200 оборотах в минуту. Степень сжатия равнялась 9,6:1. Параллельно велся выпуск более мощного аналога 4E-FTE.

Характеристики 4E-FE второго поколения были значительно изменены. В первую очередь это коснулось мощности. Мотор введен в эксплуатацию в 1996 году. Он выдавал мощность 88 л.с. при 5500 об/мин. Благодаря новой системе установки коллекторов и их режима работы, производителю удалось сильно сократить выбросы отработанных газов в атмосферу.

4E-FE под капотом

Третье поколение двигателей устанавливалось на марки Toyota Corolla и Starlet с 1997 по 1999 год. Их максимальная мощность составляла 82 л.с. Для установки в модельный ряд Starlet была проведена модернизация, что способствовало увеличению мощности до 85 л.с. Главным отличием от второго поколения был видоизмененный впускной коллектор. В 1999 году производство 4E-FE было полностью остановлено.

Куда устанавливали

На протяжении 10 лет мотор был частью таких автомобилей:

  • Starlet;
  • Tercel;
  • Corolla;
  • Paseo;
  • Cynos;
  • Corsa.

Двигатель 4E-FE не сыскал популярности в России и мире. Причиной тому послужили небольшой ресурс и малая мощность, ограничивающая область его использования.

Двигатель 4E-FE (Тойота): характеристики, минусы, проблемы, ГРМ

Автор Михаил На чтение 7 мин Опубликовано Обновлено

1.3-литровый

 4E-FE на бензине производился Тойота в период 1989 2001 год и устанавливался на множество машин. Но известен в основном по модели Королла.

Выпускалась также модификация этого силового агрегата с маркировкой 4E-FTE, с турбонаддувом.

Двигатель 4E-FE

Характеристики 4E-FE

Двигатель 4E-FE

Двигатель 4E-FE имеет следующие технические характеристики:

Расход топлива

Потребление бензина Тойота Королла Е110 с 5МКПП (л/100 км):

в городе – 7.7;

на трассах за городом – 5,1;

смешанный цикл – 6,8.

Toyota Corolla E110 1999 года

Расход топлива Тойота Королла Е110 с 4АКПП (л/100 км):

в городе – 10,3;

за городом – 6,4.

Модификации мотора 4E-FE

Бензиновый 1.33 4E-FE принадлежит к малолитражной серии (Е) ДВС Тойоты. Использовалась эта серия на моделях Caldina, Corolla, Starlet

, Tercel.

К базовым ДВС Е-серии относятся:

Если в маркировке двигателя Тойота присутствует буква Т, она указывает на турбоннаддув.

Технические особенности

Ремень ГРМ, вращает один распредвал, а второй соединен с ним шестерней

Двигатель Тойота 1.33 4E-FE характеризуется EFI-распределённым впрыском, его начали выпускать в 1989 году. У ДВС 4Е-ФЕ обычное строение: блок цилиндров из чугуна (рядный), 16-клапанная головка блока цилиндров из алюминия, ремень ГРМ, вращает один распредвал, при этом второй с ним соединяется шестерней. Клапанные зазоры иногда требуется регулировать, т.к. гидрокомпенсаторы не устанавливали.

Блок цилиндров 4E-FE (ссылка на источник изображения)

В случаях обрывов или перескока ремня ГРМ 4E-FE клапана не гнутся.

Существуют три поколения данного двигателя: 1989, затем 1996 и 1997 годов. Имеющиеся различия между ДВС минимальны, сводились они в основном к о

бновлению впуска либо выпуска.

Ремень ГРМ 4E-FE

Формально серия Е не подлежит капремонту, при этом заметно уступает по ресурсу представителям серии А. Если двигатель серии Е соответствует классу машины, то он отрабатывает свой ресурс без проблем. Но если он слабоват (как 4E-FE для Corolla), работает на пределе и изнашивается значительно раньше времени.

Обслуживание 4E-FE

Двигатель 4E-FE

Перечислим основной регламент сервисного обслуживания, которого требует двигатель 4Е-ФЕ:

  1. Периодичность замены масла – каждые 10 000 км. Объем масла в двигателе – 3.2 литра, для замены требуется – 2.8 литра. Подходящее масло – 5W-30 -W40.

    Toyota «ENGINE OIL 5W-40»

  2. Привод ГРМ – резиновый ремень. Срок службы – 100,000 пробега, но лучше менять каждые 80,000 из-за сложных условий.
  3. Регулировка клапанов требуется раз в 100 тысяч км, осуществляется подбором шайб.
  4. Топливный фильтр 4E-FE нужно менять каждые 40 тысяч пробега. Топливный фильтр внутри бака менять не нужно.

    Сервисный набор для 4E-FE: воздушный фильтр, топливный и масляный фильтры

  5. Воздушный фильтр меняется раз в 20,000.
  6. Свечи зажигания по плану меняются каждые 30 тысяч км.
  7. Охлаждающую жидкость или антифриз следует менять через 24 месяца или 40 тысяч пробега.

Недостатки и слабые места 4Е-ФЕ

Перечислим основные слабые места двигателя 4E-FE.

  1. Он подвержен быстрому перегреву, часто пробивается прокладка ГБЦ. Затвердевают и начинают протекать сальники, от повышенных температур. Система охлаждения требует постоянного контроля, с ней возможны неожиданные проблемы.

    прокладка ГБЦ двигателя 4E-FE

  2. Бензин плохого качества приводит к быстрому забиванию топливных форсунок. Из-за плохого топлива клапан холостого хода и дроссель покрываются слоем нагара. В результате 4E-FE начинает работать с перебоями.
  3. Перерасход масла становится заметным уже через 120-150 тыс. км. К этому времени маслосъёмные колпачки уже изнашиваются и кольца начинают «залегать».

    Кольца начинают «залегать»

  4. Срок работы ремня ГРМ заявлен производителем на уровне 100 тысяч пробега, но на практике резиновый ремень изнашивается раньше. Однако, несомненный плюс данного двигателя – в случаях обрыва зубчатого ремня ГРМ в ДВС клапана не гнутся.

Как все старые двигатели, 4Е-ФЕ может беспокоить всякими мелкими поломками: то масло протекает, то система зажигания подводит, то лямбда-зонд или другие датчики прекращают работать.

Еще минусы: периодически требуется регулировать клапана, т.к. отсутствуют гидрокомпенсаторы.

Заявленный производителем ресурс ДВС220 тыс. км., но при надлежащем обслуживании он увеличивается до 300 тыс. км.

Отзывы

Уважаемые Читатели на нашем сайте пока нет отзывов о моторе 4E-FE. Если Вы хотите поделиться своим опытом, мнением, то оставляйте их в виде комментариев в любой форме.

Спасибо.

На какие автомобили устанавливался

4E-FE устанавливался на:

  1. Corolla E100: 1991-1998

    Corolla E100 рестайлинг 1995

  2. Corolla E110: 1995-2001
  3. Cynos L40: 1991-1995
  4. Cynos L50: 1995-1999
  5. Starlet P80: 1989-1995
  6. Starlet P90: 1989-1995

    Starlet P90 1995 года

  7. Tercel L40: 1990-1994
  8. Tercel L50: 1994-1999

    Tercel L50

Заключение

Тойоту можно поблагодарить за создание моторов «для людей», т.к. их ДВС, в т.ч. и двигатель 4Е, отличаются разумными и простыми идеями и такой же их реализацией. Никаких излишеств и непонятных дополнений, только практичность, надёжность и приличный ресурс. Простых автолюбителей такие характеристики моторов вполне удовлетворяют.

Видео

Двигатель 4e fe технические характеристики, плюсы и минусы

Двигатели Тойота серии Е конструировались изначально с целью уменьшения выбросов в окружающую среду и достижения топливной экономичности для регулярного, повседневного использования. Они были в своем роде пионерами, так как оснащались 4-мя чугунными цилиндрами, имеющими прямое расположение, и алюминиевой головкой для поршневого мотора, а также зубчатым ремнем газораспределительного механизма для привода, двигатель

4e fe не исключение.

Общая информация о двигателе 4Е-FE

Мотор — 16-клапанный 4-циллиндровый двигатель, сконструированный и произведенный в Японии, с резервуаром на 1,3 литра для топлива (обычно использовали бензин АИ-95 и АИ-92). Двигатель производился с 1989 по 1999 год и комплектовался в следующие машины:

  • Corrolla;
  • Corsa;
  • Cynos;
  • Тarcel;
  • Passeo;
  • Starlet.

Противовесы в 5-опорном коленчатом вале разгружали подшипники, а отверстия в коленвале проделывались для подвода масла, предохраняя тем самым трущиеся элементы от быстрого стачивания. Свечи зажигания в двигателе размещались внутри полой части цилиндров, распределительный вал приходил в движение при помощи ремня ГРМ коленчатого вала. Причем ремень (ГРМ) требовал замены после прохода каждых восьмидесяти тыс. километров.

Несмотря на свою конфигурацию и экономичное использование топлива, двигатели 4E-Fe не стали популярными из-за малого ресурса и незначительной мощности.

Основные характеристики мотора

На протяжении 10 лет было выпущено 3 поколения моторов 4E-FE литражом от 1 до 1,5 литра и мощностью от 85 до 99 л.с. (в конфигурации 4E-FTE – 133 л.с.). В каждом поколении были незначительные видоизменения и мелкие усовершенствования механизма.

Таблица №1. Характеристики агрегата

Основные параметры Значения параметров
Вместительность резервуара мотора, литры 1,331
Конфигурация L
Количество цилиндров, штуки 4
Диаметр окружности цилиндров, мм 74
Число клапанов в штуках на цилиндр 4
Уровень сжатия 9,6
Движение поршня, в миллиметрах 77,4
Механизм газораспределения DOHC
Последовательность функционирования цилиндров 1-3-4-2
Возможность достичь мощности мотора при частоте вращения крутящего момента коленвала 74 кВт или 99 л. с. при 6,6 тыс. об./мин.
При частоте вращении коленчатого вала следующие максимальные показателя крутящего момента 5,2 тыс. об/мин при 117 Н*м
Вес, кг 105
Система моторного питания Впрыск с распределением и управлении электроникой
Минимальное значение октана для топлива 92
Нормы и требования экологов

Параметры двигателей разных поколений

  1. Моторы I поколения устанавливались на машины с 1989 по 1996 год и развивали 99 л. с при 6,6 тыс. об/мин и 117 Н/м при 5,2 тыс. об/мин. Они больше всего похожи на моторы 4Е-FTE корпусом и размером форсунок, а в остальном – различаются количественные величины некоторых показателей. Степень сжатия, к примеру, у агрегата 4E-FE, составляет 9,6 к одному.
  2. Вывод на рынок конструкции II поколения был произведен в 1996 году и в ней снизили мощность двигателя до 88 л. с. при 5,5 тыс. об/мин (118 Н/м при 4,4 оборотах). Также для снижения объема выброса вредоносных газов в атмосферу была перенастроена система блока управления мотора и слегка видоизменен коллектор, работающий на впуск и выпуск.
  3. Изменения, произошедшие с мотором III поколения идентичны с предыдущим. Он стал устанавливался с 1997 года с производительностью равной в 82-85 л.с.

В 1999 году выпуск линейки агрегатов 4E-FE был окончательно прекращен.

Строение мотора

4E-FE – 4-тактный 16-клапанный 4-цилиндровый мотор с бензиновым двигателем внутреннего сгорания. Оснащен системой охлаждения жидкости закрытого типа с обязательной циркуляцией и комбинированной смазкой основных деталей, послушной электронному управлению механикой процесса впрыскивания топлива, прямо расположенными поршнями и цилиндрами, которые вращают единственный коленвал.

Вал коленчатый

Коленвал с восьмью противовесами в пять опор, укрепленными на продолжении шеек, с подводом смазки к подшипникам (шатунным и коренным), а также иным деталям, подверженным сильному трению.

Шатуны поршни и цилиндры

Алюминиевые поршни оснащены углублениями на днище, предотвращающими контакт с клапанами в момент разрыва ремня ГРМ.

Цилиндровый блок несмотря не отлитие из чугуна довольно просто растачивается до нужных значений. Диаметр поршневых пальцев наружного типа составляет 20 мм.

Предлагаем вашему вниманию прайс на контрактный двигатель(без пробега по РФ) 4e fe

Прайс-Лист

Toyota 4E-FE: Характеристики двигателя — AVTO-NINJA

Toyota 4E-FE — это 1.3 л (1331 куб.см.) четырехцилиндровый, 4- х тактный бензиновый двигатель от Toyota E-семейства. Двигатель Toyota 4E-FE изготовлялся с 1989 года и был снят с производства после 1999 года.

Двигатель 4E-FE оснащен чугунным блоком и алюминиевой головкой цилиндров с двумя верхними распределительными валами (DOHC) и четырьмя клапанами на цилиндр (всего 16). Степень сжатия составляет 9,6: 1. Он имеет диаметр цилиндра 74,0 мм и ход поршня 77,4 мм. Двигатель Toyota 4E-FE имеет электронную систему впрыска топлива и систему зажигания с распределителем.

Двигатель производит мощность от 75 л.с. (55 кВт; 74 л.с.) при 5400 об/мин до 100 л.с. (74 кВт; 99 л.с.) при 6600 об/мин максимальной мощности и от 110 Н · м (11,2 кг · м) при 3600 об/мин — 117 Н · м (11,9 кг · м) при 4000 об/мин пикового крутящего момента.

В процессе производства было доступно три поколения двигателя 4E-FE. Двигатели отличались в основном модифицированными впускным и выпускным коллекторами и ЭБУ, в результате у него отличались выходная мощность и крутящий момент.

Разбивка кода двигателя выглядит следующим образом:

  • двигатель 4 — 4 поколения
  • E — семейство двигателей
  • F — Экономичный узкоугольный DOHC
  • E — многоточечный впрыск топлива
Характеристики двигателя 4E-FE
Код двигателя4E-FE
ВидЧетырехтактный Inline-4 (Straight-4)
Тип топливаБензин
Годы производства1989-1999
Объём1,3 л, 1331 см 3 (81,22 у.е.)
Топливная системаЭлектронный впрыск топлива (EFI)
Турбина-
Лошадиные силыОт 75 л.с. (55 кВт; 74 л.с.) при 5400 об/мин
до 100 л.с. (74 кВт; 99 л.с.) при 6600 об/мин
Крутящий моментОт 110 Н · м (11,2 кг · м) при 3600 об/мин
до 117 Н · м (11,9 кг · м) при 4000 об/мин
Порядок работы цилиндров1-3-4-2
Размеры (Д × В × Ш)-
Вес-

Блок цилиндров 4E-FE

Toyota 4E-FE имеет чугунный блок цилиндров с системой поддержки с пятью подшипниками. Он имеет диаметр цилиндра 74,0 мм и ход поршня 77,4 мм. Степень сжатия составляет 9,6: 1. Двигатель имеет коленчатый вал с восемью противовесами.

Двигатель оснащен стальными шатунами, поршневыми пальцами поплавкового типа, поршнями из алюминиевого сплава с двумя компрессионными и одним масляным контрольным кольцом. Верхнее компрессионное кольцо выполнено из нержавеющей стали, второе кольцо из чугуна.

Блок цилиндров
СплавЧугун
Коэффициент сжатия9.6: 1
Диаметр цилиндра74,0
Ход поршня77,4
Поршневые кольца: компрессия/масло2/1
Коренные подшипники5
Внутренний диаметр цилиндра74.000-74.010
Диаметр юбки поршня73,900-73,910
Боковой зазор поршневого кольцаверхний 0,040-0,080
второй 0,030-0,070
Кольцевой зазор поршневого кольцаверхний 0,260-0,360
второй 0,150-0,300
масло 0,130-0,538
Диаметр шейки коленвала46,985-47,000
Диаметр шатуна39,985-40,000

Процедура затяжки болтов крышки коренных подшипников и характеристики крутящего момента:

● 57 Нм, 5,8 кг · м

После закрепления болтов крышек подшипников убедитесь, что коленчатый вал плавно вращается рукой.

Болты шатунов

● 39 Нм, 4,0 кг · м

ГБЦ 4E-FE

ГБЦ изготовлена ​​из алюминиевого сплава, что обеспечивает хорошую эффективность охлаждения. Двигатель имеет два верхних распределительных вала, которые приводятся в движение зубчатым ремнем и четыре клапана на цилиндр (всего 16). Двигатель 4E-FE использовал специальные прокладки клапана для регулировки зазора клапана.

ГБЦ
Тип ГРМDOHC, ременная передача
Клапаны16 (4 клапана на цилиндр)
Скорость впуска/выпуска-
Диаметр тарелки клапана-
-
Длина клапанаЗАБОР 93,45
ВЫПУСКНАЯ 93,89
Диаметр стержня клапанаЗАБОР 5,970-5,985
ВЫПУСКНАЯ 5,965-5,980
Длина пружины клапана свободная39,8
Высота кулачка распредвалаЗАБОР 41,510-41,610
ВЫПУСКНАЯ 41,310-41,410

Процедура затяжки головки и характеристики крутящего момента:

  • Шаг 1: 44 Нм, 4,5 кг · м
  • Шаг 2. Поверните все болты на 90 °.

Болты крышки подшипников распредвала

● 13 Нм (1,33 кг · м)

Зазоры клапанов
Впускной клапан0,15-0,25
Выпускной клапан0,31-0,41
Степень сжатия
Стандарт13,0 кг / м 2 /200 об
Масло в двигатель
Масло в двигатель5W-20, 5W-30, 10W-30
API типа маслаSG или SF
Сколько масла в двигателе, лС заменой фильтра 3.2 лл
Без смены фильтра 2,9 л
Замена масла проводится, км5000-10 000
Система зажигания
Свеча зажиганияDENSO: K16R-U, NGK: BPR5EYA
Искровой промежуток0,8
С каким усилием затягивать свечи?-
Двигатель устанавливается в:
МодельГоды выпуска
Toyota Starlet
Toyota Tercel
Toyota Corolla
Toyota Paseo
Toyota Cynos
Toyota Corolla II
Toyota Sprinter
Toyota Corsa

Денис — специалист в сфере автомобилей. Он имеет 5-летний опыт работы на СТО и пишет про новости в мире автомобилей. Теперь он делится своими знаниями с людьми, рассказывает про устройство и ремонт современных авто.

SAT ST1670002 Ремкомплект маслонасоса TOYOTA 4E-FE/5E-FE - цена и аналоги:

 

Информация для покупателей

Просим вас быть бдительными при переводе денежных средств третьим лицам.

Фильтр

  • срок доставки
  • Доступное количество
  • Сбросить

Представленные на сайте цены товара SAT ST1670002 Ремкомплект маслонасоса TOYOTA 4E-FE/5E-FE указаны с учетом доставки до пункта самовывоза в городе Новокузнецк.

Для уточнения стоимости доставки по России Вы можете обратиться к менеджеру нашего интернет-магазина по указанным контактам. Для самостоятельного рассчета доставки воспользуйтесь нашим онлайн-калькулятором рассчета доставки. 

 

 

 

Чтобы купить SAT ST1670002:

1. Определитесь со сроками, выберите необходимое количество и добавьте SAT ST1670002 в корзину.

2. Оформите заказ, следуя подсказкам в корзине.

3. Оплатите заказ, выбрав удобный способ оплаты. Напоминаем, что мы работаем только по 100% предоплате.

4. Если товар в наличии - Вы можете буквально сразу же получить его в нашем пункте самовывоза.

Каждая запчасть имеет свою применимость к определённым маркам автомобиля. Обязательно перед оформлением заказа убедитесь, что SAT ST1670002 Ремкомплект маслонасоса TOYOTA 4E-FE/5E-FE подходит к Вашему автомобилю.

Информация по заменителям (дубликатам, заменам, аналогам) имеет исключительно справочный характер и не гарантирует совместимость с вашим автомобилем! Если Вы не уверены в том, что выбранная Вами деталь подходит к Вашему транспортному средству - обратитесь за помощью к менеджеру по подбору запчастей.

Размещённая на сайте информация (описание, технические характеристики, а так же фотографии) приведена для ознакомления и не является публичной офертой. Не может служить основанием для предъявления претензий в случае изменения характеристик, комплектности и внешнего вида товара производителем без уведомления.

Двигатель Toyota 4E-FTE | Гаражный АвтоМастер

Турбо на каждый день, Тойота Королла 2, 4E-FTE, FAZ-Garage

Повседневная турбо-машина, Toyota Corolla II, свапнутая на турбо 4E-FTE и с множеством тюняшек и мощностью в 180 л.с….

Toyota Starlet GT Turbo Glanza 4EFTE EP82 EP91 External Gate Big Turbo 12 Second Cars

Just a compilation of Acceleration runs with a heavy foot and lots of boost and wheel spin, external gate and a burnout from a S15 Nissan.

Engine Toyota 4E-FTE

Fadli Jaya Motor merupakan supplier sparepart dan mesin mobil copotan ex singapore, jepang, hongkong, korea, malaysia, dubai, australia dll untuk berbagai …

Замена ГРМ 4e-fe toyota ae100. нюансы. каталог запчастей

Все возникающие вопросы пишите в комментарии — сниму видеоответы. Группа в контакте vk.com/gregs_garage IG: @gregs_garage…

PRO Swap — Smart Roadster на 4E-FTE от Toyota

Очень редкая машинка, хозяин которой решился на свап! Долгая дорога к мотору от Toyota и потенцеал в 200лс на…

Toyota Starlet P8 4E-FTE 1.3 Turbo Glanza Engine — Brutal Screamer Acceleration 200+HP

Here a video from a Toyota Starlet P8 1.3 4E-FTE Glanza engine with screamer pipe over 200 HP. Boost @ 1,1 bar/16 psi. Blowoff valve and flutter sounds.

Toyota Starlet 4EFE ITB

Just a little video of my Starlet with throttle bodies. Hope you enjoy the sound of 40mm throttles.

4e fe 1300cc

Toyota Starlet 4E-FE Контрактный мотор в продаже! EP91

4E-FE Контрактный мотор в продаже! Видео машины в Японии.

Diy Budget Turbo 4efe — Setup

Walk round and info on my 4efe turbo setup running Ct9 on a ecu master det3.

Двигатель Toyota 4E-FTE — технические характеристики . Распространенные неисправности и эксплуатация .

Смотрите видео обзор про Двигатель Toyota 4E-FTE . Отзывы автомастеров и владельцев на Двигатель Toyota 4E-FTE , его плюсы и минусы , а также его достоинства и недостатки

Все советы , про Двигатель Toyota 4E-FTE основанны на личном опыте автомастеров и автовладельцев .

Двигатель Toyota 4E-FTE : Характеристики , неисправности и их причины, отличия модификаций. Какое масло лить, ресурс, тюнинг и прочее.

Для тех , кто привык пользоваться обычными печатными изданиями , рекомендуем купить руководства по ремонту автомобилей в крупнейших магазинах России и Украины

krutilvertel - Электронные книги типографского качества в формате PDF
autodata - Интернет-магазин издательства Легион-Автодата
autoinform96 - литература по ремонту и эксплуатации автомобилей в России и Украине

Обзор и технические характеристики

, сервисные данные

Toyota 4E-FE - это четырехтактный четырехтактный рядный четырехтактный бензиновый двигатель Toyota E-семейства объемом 1,3 л (1331 куб. См, 81,22 куб. Дюймов). Двигатель Toyota 4E-FE производился с 1989 года и был снят с производства после 1999 года.

Двигатель 4E-FE имеет чугунный блок и алюминиевую головку блока цилиндров с двумя верхними распредвалами (DOHC) и четырьмя клапанами на цилиндр (всего 16 ). Степень сжатия 9,6: 1. Он имеет диаметр цилиндра 74,0 мм (2,91 дюйма) и диаметр 77 мм.Ход поршня 4 мм (3,05 дюйма). Двигатель Toyota 4E-FE имеет электронную систему впрыска топлива и систему зажигания с распределителем.

Двигатель производился от 75 л.с. (55 кВт; 74 л.с.) при 5400 об / мин до 100 л.с. (74 кВт; 99 л.с.) при 6600 об / мин максимальной мощности и от 110 Н · м (11,2 кг · м, 81,1 фунт-сила-футов). ) при 3600 об / мин до 117 Н · м (11,9 кг · м, 86,2 фут-фунт) при 4000 об / мин максимального крутящего момента.

В процессе производства было доступно три поколения двигателей 4E-FE. Двигатели отличались в основном доработанными впускным и выпускным коллекторами и ЭБУ, как следствие, отличались выходной мощностью и крутящим моментом.

Код двигателя выглядит следующим образом:

  • 4 - Двигатель 4 поколения
  • E - Семейство двигателей
  • F - Экономичный узкоугольный DOHC
  • E - Многофункциональный Точечный впрыск топлива

Общая информация

Технические характеристики двигателя
Код двигателя 4E-FE
Компоновка Четырехтактный, рядный-4 (прямой-4)
Топливо тип Бензин (бензин)
Производство 1989-1999 гг.
Рабочий объем 1.3 л, 1331 см 3 (81,22 куб.дюйма)
Топливная система Электронный впрыск топлива (EFI)
Сумматор мощности Нет
Выходная мощность От 75 л.с. (55 кВт; 74 л.с.) при 5400 об / мин
до 100 л.с. (74 кВт; 99 л.с.) при 6600 об / мин
Выходной крутящий момент От 110 Н · м (11,2 кг · м, 81,1 фунт-фут) при 3600 об / мин от
до 117 Н · м (11,9 кг · м, 86,2 фунт-фут) при 4000 об / мин
Порядок стрельбы 1-3 -4-2
Размеры (Д x Ш x В): -
Вес -

Блок цилиндров

Toyota 4E-FE имеет чугунный блок цилиндров с пятью система поддержки подшипников.Он имеет диаметр цилиндра 74,0 мм (2,91 дюйма) и ход поршня 77,4 мм (3,05 дюйма). Степень сжатия 9,6: 1. Двигатель имеет коленчатый вал с восемью противовесами.

Двигатель комплектуется стальными шатунами, поршневыми пальцами поплавкового типа, поршнями из алюминиевого сплава с двумя компрессионными и одним маслосъемным кольцом. Верхнее компрессионное кольцо изготовлено из нержавеющей стали, второе кольцо - из чугуна.

Блок цилиндров
Сплав блока цилиндров Чугун
Степень сжатия: 9.6: 1
Диаметр цилиндра: 74,0 мм (2,91 дюйма)
Ход поршня: 77,4 мм (3,05 дюйма)
Количество поршневых колец (компрессионных / масляных): 2 / 1
Количество коренных подшипников: 5
Внутренний диаметр цилиндра (стандартный): 74,000-74,010 мм (2,9134-2,9138 дюйма)
Диаметр юбки поршня (стандартный): 73.900-73.910 мм (2,9094-2,9098 дюйма)
Внешний диаметр поршневого пальца: -
Боковой зазор поршневого кольца: Верхний 0,040-0,080 мм (0,0016-0,0031 дюйма)
Второй 0,030-0,070 мм (0,0012-0,0028 дюйма)
Торцевой зазор поршневого кольца: Верхний 0,260-0,360 мм (0,0102-0,0142 дюйма)
Второй 0,150-0,300 мм (0,0059-0,0118 дюйм)
Масло 0.130-0,538 мм (0,0051-0,0212 дюйма)
Диаметр шейки коленчатого вала: 46,985-47,000 мм (1,8498-1,8504 дюйма)
Диаметр шатуна: 39,985-40,000 мм (1,5742-1,5748 дюйма)

Порядок затяжки и момент затяжки болтов крышки коренного подшипника:

  • 57 Нм, 5,8 кг · м; 42 фут-фунт)

После затяжки болтов крышки подшипника убедитесь, что коленчатый вал вращается плавно вручную.

Болты шатуна

  • 39 Нм, 4.0 кг · м; 29 фунт-фут)

Головка блока цилиндров

Головка блока цилиндров изготовлена ​​из алюминиевого сплава, что обеспечивает хорошую эффективность охлаждения. Двигатель имеет два верхних распределительных вала, которые приводятся в движение ремнем газораспределительного механизма и четырьмя клапанами на цилиндр (всего 16 клапанов). В двигателе 4E-FE для регулировки зазора клапана использовались специальные прокладки клапанов.

Головка блока цилиндров
Расположение клапанов: DOHC, ременной привод
Клапаны: 16 (4 клапана на цилиндр)
Диаметр головки клапана: ВПУСКНОЙ -
ВЫХЛОПНАЯ -
Длина клапана: ВПУСКНОЙ 93.45 мм (3,6791 дюйма)
ВЫХЛОПНАЯ 93,89 мм (3,6964 дюйма)
Диаметр штока клапана: ВПУСКНОЙ 5,970-5,985 мм (0,235-0,2356 дюйма)
ВЫПУСКНОЙ 5,965-5,980 мм (0,2348-0,2354 дюйма)
Свободная длина пружины клапана: 39,8 мм (1,5669 дюйма)
Высота кулачка распредвала: ВПУСКНОЙ 41,510-41,610 мм (1,6342- 1,6382 дюйма)
ВЫХЛОПНАЯ КОРОБКА 41.310-41,410 мм (1,6264-1,6303 дюйма)
Наружный диаметр шейки распределительного вала: №1 24,949-24,965 мм (0,9822-0,9829 дюйма)
Диаметр других шеек 22,949-22,965 мм (0,9035–0,9041 дюйма)

Процедура затяжки головки и характеристики крутящего момента:

  • Шаг 1: 44 Нм, 4,5 кг · м; 32,5 фунт-фут
  • Шаг 2: Поверните все болты на 90 °

Болты крышки подшипников распределительного вала

  • 13 Нм (1.33 кг · м; 9,6 фунт-фут)

Технические данные

Клапанный зазор
Впускной клапан 0,15-0,25 мм (0,006-0,010 дюйма)
Выпускной клапан 0,31-0,41 мм ( 0,012-0,016 дюйма)
Давление сжатия
Стандартное 13,0 кг / м 2 /200 об / мин
Минимальное 10,0 кг / м 2 /200 об / мин
Предел перепада сжатия между цилиндрами 1.0 кг / м 2 /200 об / мин
Масляная система
Расход масла, л / 1000 км (кварт на милю) до 0,5 (1 кварт на 1200 миль)
Рекомендуемое моторное масло 5W-20, 5W-30, 10W-30
Тип масла API SG или SF
Объем моторного масла (заправляемая емкость) С заменой фильтра 3,2 л
Без замены фильтра 2,9 л
Интервал замены масла, км (миль) 5,000-10,000 (3,000-6,000)
Система зажигания
Свеча зажигания DENSO: K16R-U, NGK: BPR5EYA
Зазор свечи зажигания 0.8 мм (0,0315 дюйма)

Данные регулировки зазора клапана

Рассчитайте толщину нового толкателя регулирующего клапана, чтобы зазор клапана находился в пределах указанных значений.

R = Толщина снятого толкателя клапана
N = Толщина нового толкателя клапана
M = Измеренный зазор клапана

Впуск:
N = R + [M - 0,20 мм (0,008 дюйма)]
Выпускной:
N = R + [M - 0,36 мм (0,014 дюйма)]

Подъемники клапана доступны в 17 размерах в диапазоне от 2.От 50 мм (0,098 дюйма) до 3,30 мм (0,130 дюйма) с шагом 0,05 мм (0,0020 дюйма).

Пример (впускной клапан):
R = 2,60 мм
M = 0,55 мм
N = 2,60 + (0,55 - 0,20) = 2,95 мм.

Применение в автомобилях

Модель Год выпуска
Toyota Starlet -
Toyota Tercel -
Toyota Corolla -
Toyota Paseo -
Toyota Cynos -
Toyota Corolla II -
Toyota Sprinter -
Toyota Corsa -
ВНИМАНИЕ! Уважаемые посетители, данный сайт не является торговой площадкой, официальным дилером или поставщиком запчастей, поэтому у нас нет прайс-листов или каталогов запчастей.Мы информационный портал и предоставляем технические характеристики бензиновых и дизельных двигателей.

Мы стараемся использовать проверенные источники и официальную документацию, однако могут возникнуть расхождения между источниками или ошибки при вводе информации. Мы не консультируем по техническим вопросам, связанным с эксплуатацией или ремонтом двигателей. Мы не рекомендуем использовать предоставленную информацию для ремонта двигателей или заказа запчастей, используйте только официальные сервис-мануалы и каталоги запчастей.

Тойота Королла 1.3L 4E-FE

Toyota Corolla 1.3L 4E-FE

Тойота Королла 1.3L 4E-FE

Производитель: Toyota
Модель: Corolla 1.3L
ECU: Toyota TCCS
Код двигателя: 4E-FE
Настроен для: R-Cat

63 Модуль управления переменного тока
30 Аккумулятор +
31 Аккумулятор -
54 Датчик положения коленчатого вала (CKP)
1 Разъем канала передачи данных (DLC)
35 Модуль управления двигателем (ECM)
K46 Реле управления двигателем
K12 Реле электродвигателя вентилятора охлаждающей жидкости
24 Датчик температуры охлаждающей жидкости двигателя ()
H63 Контрольная лампа неисправности двигателя (MIL)
M12 Топливный насос
20 Реле топливного насоса
F Предохранитель
72 Подогреваемый кислородный датчик (HO2S)
Y99 Клапан регулировки холостого хода (IAC)
52 Усилитель зажигания
1 Катушка зажигания
15 Замок зажигания - зажигание включено
50 Замок зажигания - сигнал пуска
162 Блок управления иммобилайзером
Y3 Инжектор
B25 Датчик температуры воздуха на впуске (IAT)
69 Датчик детонации (КС)
B83 Датчик абсолютного давления в коллекторе (МАР)
S259 Переключатель парковочного / нейтрального положения (PNP)
K145 Реле габаритных / задних фонарей
P7 Тахометр
147 Датчик положения дроссельной заслонки (TP)
B33 Датчик скорости автомобиля (VSS)

bl = синий
br = коричневый
el = кремовый
ge = желтый
gn = зеленый
gr = серый
nf = нейтральный
og = оранжевый
rs = розовый
rt = красный
sw = черный
vi = фиолетовый
ws = белый
hbl = голубой
hgn = светло-зеленый
rbr = бордовый

18.08.2004

toyota - 99 двигатель Corolla 4E-FE 1.3 - возможна детонация, помпаж

Извините, что присоединился и сразу же задаю вопрос, но я в тупике со своей старой Corolla.

У меня не было этого очень долго, всего около 1500 миль, но у меня есть пара мелких проблем, из-за которых я застрял.

Первое, я надеюсь, не детонация. Я записал здесь клип, демонстрирующий получаемый мной шум. Королла Шум

Это действительно происходит только на 4-й и 5-й передачах между 2000-2500 об / мин с нагрузкой на двигатель, иногда с небольшой нагрузкой на 3-й и 6-й передачах.

Вторая проблема, которая может быть связана, заключается в том, что при отметке около 1800-2000 об / мин при постоянной скорости с очень низким входом газа автомобиль слегка дергается, почти как очень легкий пропуск зажигания / помпаж. Если вы дадите ему больше газа, он продолжит работу. Иногда он будет немного колебаться, делая это.

После того, как я проехал всего пару сотен миль на машине, мне пришлось заменить прокладку головки блока цилиндров, поскольку она протекала между каналом охлаждающей жидкости и атмосферой, поэтому охлаждающая жидкость выталкивалась из боковой части двигателя.К сожалению, он этого не делал, когда я его покупал, или в течение первых нескольких сотен миль. Мне удалось поймать это и сделать это до того, как он перегрелся, и обе вышеперечисленные проблемы присутствовали до того, как они были исправлены. У машины есть полная история обслуживания.

С тех пор я без проблем проехал более 1000 миль, машина работает отлично, не считая этих двух проблем. Возврат 42 имперских миль на галлон, что примерно соответствует моим ожиданиям, и прошел выбросы незадолго до того, как я его купил. Он проехал 96 тысяч миль.

Пока пробовал:

  • Новые заглушки Denso K16TR11
  • Протестировал TPS, вроде нормально и работает правильно.
  • Замена масла и фильтра.
  • Пробежал несколько танков Shell V-Power, чтобы посмотреть, помогло ли это, ничего особенного не изменилось.
  • Кратко проверил на предмет утечек вакуума и не смог найти ничего, кроме первых ступеней возвратного шланга PCV, но утечки не обнаружено.
  • Проверено на наличие кодов неисправностей, ничего не сохранено.

Этот двигатель был последней версией 4E-FE, который у нас был в Великобритании, поэтому он использует датчик кривошипа и потерянную искру с регулировкой угла опережения зажигания, а не настройку распределителя на других моделях, поэтому я не могу отрегулировать / проверить время.

Сначала я подумал, что датчик MAP немного не работает, но, надеюсь, я немного параноик, когда вышеупомянутый шум является детонацией.

Любая помощь приветствуется, я большой фанат Toyota и очень люблю эту машину, поэтому я хотел бы, чтобы она продержалась какое-то время.

Toyota - двигатель 4E-FE - Japan Partner

Делать anyToyotaNissanHondaMitsubishiMercedes-BenzBMWMazdaSubaruVolksWagenSuzukiLand RoverIsuzuAudiFordDaihatsuLexusAcuraAICHIAIRMANAlfa RomeoAMGAndoapriliaARACOArimitsuATEXATVBARONESSBentleyBEREMABICYCLEBoatBobcatBOMAGBRANSONBuickCadillacCANY COMCATChevroletChryslerCitroenCosmoDae DongDenbaDenyoDodgeDucatiDURO BOATEUNOSFiatForkliftFreightlinerFUJIIFurukawaG-wleelGANSOWGMGMCGS ForkliftGYROHANIXHANTAHasqvarnaHelicopterHinoHINOMOTOHitachiHOKUETSUHUMMERHYOSUNGHYSTERHyundaiICEBEAR MOTORSPORTSIHIIkeyaInfinitiINTERNATIONAL HARVESTERIsekiIvecoJaguarJCBJEEPJLGJouban KougyouJP Мощность Лебедка JSKKaercherKANDIKATOKAWABEKawasakiKAWASHIMAKIAKIORITZKobelcoKomatsuKONMAKramerKubotaKYMCOKYORITSUKyoueiLanciaLGlILiebherrLincolnLINDELosenhausenLotusMalagutiMarine boatMARUNAKAMaruyamaMaseratiMassey FergusonMAZDA AUTOZAMMeiwaMGMIKASAMINIMitsubishi FusoMitsuokaNAGANONAGANO INDUSTRYNAGAOKANEW HOLLANDNICHIYUNihon Юшин DenkiNISSAN DIESELNissan UDOHASHIOKADA-SYOJIOpelORECPeugeotPIAGGIOPontiacPorschePRINOTHProzzaRand Ro verRANGE ROVERRangerRenaultROLLS-ROYCERoverRYOBIS-MACSAABSAKAISASAKISATHOSATOHSaturnSchaeffSEA DOOSea NymphSeatSeibuSentinelShibaurashikokuShinkoShizuoka Giken SankiSHOSHINSkodaSpecial vehicleSsangYongStarSumitomoSUZUESYOWA HIKOUKI KOGYOTACOMTadanoTakagiTAKAKITATAKAOKATakeuchiTCMTMUKTOKAITOKOTOMOSTouaTRIUMPHTSUCHIYAUNICARRIERSUnknownUPRIGHTVoegeleVolvoYamahaYanaseYanmarYunicon

Модель любой

Рулевое управление anyRightLeft

Передача инфекции anyATMTAT с режимом MT

Форма транспортного средства любой snowblowerATVBICYCLEBIKEBOATbuggyBULLDOZERbuscabrioletCAMPERCar CarrierCombineCompact carCompressorConcrete Смешивание TruckconstructioncoupeCRANEDUMPDumpingEXCAVATORFarm equipmentFarm TractorFire двигателя и / или пожара TruckFork LiftForkliftForklift 3tFullGarbage TruckGeneratorGrass cutterHAND GUIDE ROLLERHard topHatchbackIndustrial Machinejet skiKEI RVKei-Trucklawn mowerlawn mowingLIFTmacineManlift truckMini ExcavatormotorcyclesnoneOpenPick-UpRollerscootersedanSkid LoadersnowblowerSnowplowspeed sprayerSUVSweepersyoberurodaTank TruckTelescopic LoaderTiller TractorTractorTrencherTRENCHERStruckTruck с CranevanwagonWheel погрузчик

Топливо любойБензинДизельГаз

Смещение, CC any100200300400500600700800

0011001200130014001500160017001800100210022002300240025002600270028002003100320033003400350036003700380030041004200430044004500460047004800400510052005300540055005600570058005006100620063006400650066006700680060071007200730074007500760077007800700810082008300840085008600870088008900

10092009300940095009600970098009

000- any100200300400500600700800

0011001200130014001500160017001800100210022002300240025002600270028002003100320033003400350036003700380030041004200430044004500460047004800400510052005300540055005600570058005006100620063006400650066006700680060071007200730074007500760077007800700810082008300840085008600870088008900

10092009300940095009600970098009

000

Год любой198119821983198419851986198719881989191199219931994199519961997199819992000200120022003200420052006200720082009201020112012201320142015201620172018201920202021- любой198119821983198419851986198719881989191199219931994199519961997199819992000200120022003200420052006200720082009201020112012201320142015201620172018201920202021

Цена, долл. США any4006008001000120014001600180020002200240026002800300032003400360038004000420044004600480050005200540056005800600062006400660068007000720074007600780080008200840086008800

2009400960098001000012000140001600018000200002200024000250005000075000100000125000150000175000200000225000250000275000300000325000350000375000400000425000450000475000500000- any4006008001000120014001600180020002200240026002800300032003400360038004000420044004600480050005200540056005800600062006400660068007000720074007600780080008200840086008800

2009400960098001000012000140001600018000200002200024000250005000075000100000125000150000175000200000225000250000275000300000325000350000375000400000425000450000475000500000

Поиск

PROJECT MU ТОРМОЗНЫЕ КОЛОДКИ ТИПА HC-CS Starlet EP82 (4E-FE) F182 Передние

Состояние: Новый Торговая марка: ПРОЕКТ MU
Возврат почтовых расходов: Покупатель оплачивает любые обратные почтовые расходы. MPN: HC800 (R210501711)
Изображение товара: НЕ фактический товар (только для справки) Номер детали производителя: HC800 (R210501711)
UPC: Не применяется
США 1994 КУБОК МИРА ТРЕНИРОВОЧНЫЙ ТОЛСТОВКА Размер M (ОЧЕНЬ ХОРОШО) & nbsp easy металлическая трубка u-образная зубная паста краска для волос косметический инструмент для сжимания масляной краски WQ & nbsp Канистра для пара ACDelco GM Оригинальное оборудование 215-469 & nbsp Для Kia Optima Rondo Ultra N / A Walker EPA Direct Fit Converter Walker Exhaust & nbsp Fuel Tank 6 '3 "Box Fits 07-09 DODGE 2500 PICKUP 260019 & nbsp Yonex Женский теннисный бадминтон Комплект из 5 пар носков Хлопковые повседневные носки 99SN028F 746648982390 & nbsp 2017/18 Ирландия Домашняя майка Large New Balance Saint Patricks Irish Green NEW & nbsp 2000 Ford Taurus Модуль управления двигателем ECU ECM OEM B2V004 & nbsp Мужские джоггеры Reebok Large Spell Out Joggers XXL, углеродно-черный, удлиненные наконечники для ногтей в форме гроба, 500 шт. Микшерный пульт MC1202 и MC1602 Руководство пользователя / Руководство пользователя (Страниц: 16) & nbsp NIKE USA 2019 SOCCER Jersey CQ4241-689 БОЛЬШОЙ МУЖСКОЙ НОВИНКА С ТЭГАМИ Рекомендуемая производителем розничная цена 90 долларов США & nbsp 1995 LIONEL ELECTRIC TRAINS AND ACCES КАТАЛОГ SORIES Sports Bamboo Charcoal Спортивные дышащие компрессионные рукава для локтей - большие для Lexus RX400h и Toyota Highlander Новая пара задних амортизаторов KYB Excel-G Struts DAC & nbsp Ty Beanie Babies Baby - PUFFER- Plush Puffin Bird D.O.B 3 ноября 1997 г. 8421041817 & nbsp CHANEL “LUNE D’ARGENT # 397” Лак для ногтей BNWOB & nbsp Bandai Figure-Rise Standard Kamen Rider Double Heatmetal Plastic Model 4573102578501 & nbsp Модуль управления двигателем / ECU / ECM / PCM ACDelco Reman Original Equipment 88961146

PROJECT MU ТОРМОЗНЫЕ КОЛОДКИ ТИПА HC-CS Starlet EP82 (4E-FE) F182 Передние

PROJECT MU ТОРМОЗНЫЕ КОЛОДКИ ТИПА HC-CS Starlet EP82 (4E-FE) F182 Передние

Двигатели eBay

Сидерофлексин 4 влияет на биогенез кластера Fe-S, метаболизм железа, митохондриальное дыхание и ферменты биосинтеза гема.

Культура клеток

Клетки K562, HepG2 и HEK293 были приобретены в Американской коллекции типовых культур (ATCC).Клетки K562 и HepG2 выращивали в RPMI (Gibco), а клетки HEK293 выращивали в базальной среде DMEM (Gibco); обе среды были дополнены 10% фетальной бычьей сывороткой (FBS) (BenchMark ™ FBS - Gemini Bio Products) и 100 Ед / мл пенициллина / стрептомицина (Invitrogen).

Подавление гена с помощью siRNA и CRISPR

Транзитный siRNA-опосредованный нокдаун был выполнен с siRNA ON-TARGETplus (humanSFXN4: L-018237-02-0005; NFS1: L-011564-01-0005; и Non-Targeting siGENOME # 2), полученный от Дхармакона.Клетки трансфицировали 12 нМ миРНК с использованием реагента для трансфекции DharmaFECT 1. Трансфекцию проводили дважды с интервалом в 3 дня, и клетки собирали через 72 часа после второй трансфекции. Для нокаута сгруппированных с регулярными интервалами коротких палиндромных повторов (CRISPR) были разработаны гидРНК, которые специально разрезали первый экзон гена SFXN4 человека (последовательность ансамбля ENSG00000183605). Последовательность направляющей РНК для SFXN4 была GTGATCCAGAAGCGCACGTT, а для скремблированного контроля была CAGTCGGGCGTCATCATGAT.Олиго были приобретены у Integrated DNA Technologies Inc. (IDT), фосфорилированы и отожжены. Отожженные олигонуклеотиды gRNA были клонированы в плазмиду lentiCRISPRv2. Лентивирус был получен с использованием упаковывающих плазмид psPAX2 и pMD2.G (плазмида Addgene № 12260 и плазмида Addgene № 12259), трансфицированных в клетки HEK293T с использованием липофектамина 2000 (Thermo Fisher). Через 48 часов после заражения лентивирусом в культуру добавляли пуромицин для отбора для интеграции лентиКРИСПР. После отбора клетки тестировали с использованием анализа T7E1 (NEB) для проверки создания вставок или делеций (INDEL).После проверки INDEL клетки разреженно высевали для выделения единичных колоний. Область связывания CRISPR амплифицировали с помощью ПЦР и секвенировали секвенированием по Сэнгеру. Секвенирование проводили с использованием анализа TIDE с использованием хроматограмм отредактированных образцов и клеток дикого типа 48 . Клоны, которые имели мутации сдвига рамки считывания в обоих аллелях, были размножены, и нокаут SFXN4 подтвержден вестерн-блоттингом.

Временная сверхэкспрессия SFXN4

кДНК SFXN4 человека, полученная от GE Healthcare Dharmacon Inc.(КДНК с подтвержденной последовательностью SFXN4 человека MGC (CloneId: 4996745) была субклонирована в pcDNA ™ 3.1 (Invitrogen). Клетки K562 трансфицировали пустой плазмидой и плазмидой SFXN4 с использованием реагента Lipofectamine ™ LTX (Invitrogen). Вкратце, 5 × 10 5 Клетки K562 высевали на 6-луночный планшет и трансфицировали 2,5 мкг плазмидной ДНК.Клетки использовали для экспериментов через 72 часа после трансфекции.

Вестерн-блоттинг

Вестерн-блоттинг выполняли, как описано ранее 49 . Готовили лизаты клеток. в буфере 1X RIPA (Millipore) с добавлением коктейля ингибиторов протеазы 1X (Roche Diagnostics).Концентрацию общего белка определяли с помощью реагента BCA (Thermo Scientific). Равные количества белков разделяли электрофорезом в SDS-полиакриламидном геле и переносили на нитроцеллюлозные мембраны. Затем мембраны инкубировали с первичными и вторичными антителами соответственно. Сигналы детектировали с использованием субстрата хемилюминесценции (Thermo Scientific). Электронно-транспортные белки детектировали с использованием коктейля тотальных человеческих антител для вестерн-блоттинга OXPHOS (ab110411) от Abcam. Основные используемые антитела: HSP60 (Cell Signaling Technology (12165 S)), SFXN4 (Thermofischer (PA5-35980)) ACO2 (Cell Signaling Technology (6571S)), PPAT (ProteinTech (15401-1-AP)), POLD1 (BD Biosciences (610972)), NFS1 (Santa Cruz Biotechnology (sc-365308)), AFG3L2 (Proteintech (14631-1-AP)), CPOX (Santa Cruz Biotechnology (sc-393388)), ALAS1 (Abnova (H00000211-Q01) ), HSP70 (Cell Signaling Technology (4876S), FTH 49 , TFR1 (Thermo Fisher (13-6800)), FECH (Santa Cruz Biotechnology (sc-377377), Flag (SigmaAldrich (F3165-1MG)), c- Myc (технология передачи сигналов клеток (2276S)), ALAS2 (Abnova (H00000212-M01), abcam (ab184964)), GLUT1 (Proteintech (21829-1-AP)), гексокиназа II (технология передачи сигналов клеток (2106S)), LDHA ( Proteintech (19987-1-AP)), CIAO1 (Cell Signaling Technology (D1B4G) 81376)), MMS19 AB (Proteintech (16015-1-AP)) и Actin (Sigma Aldrich (A3854).

Количественный RTPCR

Тотальную РНК выделяли с использованием набора High Pure RNA Isolation Kit (Roche) и qRTPCR выполняли, как описано 50 . Последовательности праймеров представлены в дополнительной таблице 1.

Анализ внеклеточного потока морских коньков

Скорость потребления кислорода и скорость внеклеточного подкисления измеряли с помощью анализатора Seahorse XF 96 (Agilent) с набором для стресс-теста клеток Agilent Seahorse XF Cell Mito Stress Test Kit. Клетки K562, обычно растущие в суспензии, выращивали в культуральных планшетах, покрытых полилизином, для прилипания.Вкратце, за день до анализа 25000 клеток на лунку помещали в среду для выращивания и инкубировали при 37 ° C и 5% CO 2 в течение ночи. В день анализа ростовую среду заменяли средой XF-Base, содержащей L-глутамин (2 мМ), пируват натрия (5 мМ) и глюкозу (10 мМ).

Измерение секретируемого лактата

Внеклеточный лактат измеряли с помощью набора для колориметрического анализа L-лактата в соответствии с инструкциями производителя (Abcam, Inc., Кембридж, Массачусетс).

Число копий митохондриальной ДНК

Число копий митохондриальной ДНК измеряли с использованием набора праймеров для мониторинга митохондриальной ДНК (мтДНК) человека (TaKaRa) в соответствии с инструкциями производителя.

Измерение с-аконитазы и анализ связывания IRE-IRP

Активность цитозольной аконитазы измеряли с использованием набора для анализа аконитазы в соответствии с инструкциями производителя (Abcam, Inc., Кембридж, Массачусетс). РНК-связывающую активность белков IRP определяли анализом сдвига электрофоретической подвижности РНК с использованием набора LightShift ™ Chemiluminescent RNA EMSA Kit (Thermo Scientific).

Кластерный флуоресцентный анализ Fe-S

Кластерный флуоресцентный анализ Fe-S выполняли, как описано 16 .Флуоресцентные сенсорные плазмиды Fe-S были щедрым подарком доктора Джонатана Дж. Силберга, факультета биохимии и клеточной биологии Университета Райса, США. Перед трансфекцией сенсорными плазмидами миРНК использовали для истощения SFXN4 или NFS1. Затем слитые конструкции Venus-GRX2 с N- и C-концами смешивали в соотношении 1: 1 по объему и котрансфицировали в клетки HEK293 с использованием FugeneHD (Promega). Через 24 часа флуоресценцию количественно оценивали с помощью проточной цитометрии.

Анализ пролиферации клеток, гибели / жизнеспособности клеток и каспазы 3/7

Пролиферацию клеток измеряли с помощью анализа включения BrdU (Cell Signaling Technology).Жизнеспособность определяли проточной цитометрией с использованием набора LIVE / DEAD ™ Viability / Cytotoxicity Kit (Thermofisher Scientific). Активность каспазы 3/7 измеряли с использованием систем анализа Caspase-Glo® 3/7 (Promega).

Активность аконитазы в геле

Активность аконитазы в геле определяли, как описано 51 . Клетки лизировали 1% буфером для лизиса тритона / цитрата (pH 7,5) (40 мМ KCl, 25 мМ трис-Cl, 1% тритон, 1 мМ DTT, 2 мМ цитрат натрия и 0,6 мМ MnCl2). Концентрацию белка оценивали с помощью реагента Брэдфорда (Biorad).Образцы загружали на гели с аконитазной активностью, состоящие из 8% разделяющего геля (акриламид (8%), 132 мМ трис-основания, 132 мМ бората и 3,6 мМ цитрата) и 4% стекирующего геля (акриламид (4%), 67 мМ Трис основание, 67 мМ борат, 3,6 мМ цитрат). Рабочий буфер представлял собой 25 мМ Трис, pH 8,3, 192 мМ глицин и 3,6 мМ цитрат. Образцы содержали 40 мкг белка, 25 мМ трис-Cl (pH 8,0), глицерин (10%) и бромфеноловый синий (0,025%). Активность аконитазы определяли путем инкубирования геля в темноте при 37 ° C в 100 мМ Трис (pH 8.0), 1 мМ НАДФ, 2,5 мМ цис-аконитовая кислота, 5 мМ MgCl 2 , 1,2 мМ МТТ, 0,3 мМ феназинметосульфат и изоцитратдегидрогеназа (5U / мл).

Анализ гемоглобина

Клетки K562 дифференцировали с использованием бутирата натрия (1 мМ, Sigma-Aldrich) в течение 3–6 дней 52 . Гемоглобин оценивали электрофорезом в нативном полиакриламидном геле с последующей визуализацией с усилением хромофора, как описано 21 . Клетки лизировали в 1X TBS (pH 7,5) (Bio Rad) обработкой ультразвуком и центрифугировали в течение 15 минут при 4 ° C и 20000 g.Собирали супернатанты и определяли общую концентрацию белка. Равные количества белка, смешанные 1: 1 с нативным буфером для образцов геля (Invitogen), подвергали электрофорезу при 125 В. Использовали 4-20% трис-глициновый гель с 1X нативным гелевым рабочим буфером (Invitogen). Белки переносили на нитроцеллюлозу на 1 час в безспиртовом буфере для переноса (трис-основание (25 мМ) и глицин (192 мМ)) с использованием переносного устройства Bio Rad mini. Гемоглобин визуализировали, инкубируя мембрану в буфере, содержащем 50 мМ Трис (pH 7.4), 50 мМ имидазола, 0,5 мг / мл диаминобензидина и 0,1% h3O2.

Анализ пула лабильного железа (LIP)

Лабильное железо измеряли, как описано ранее. 53 , 25 000–50 000 клеток высевали в 96-луночные планшеты (черные с прозрачным дном, закупленные у Coring). Клетки загружали 2 мкМ ацетоксиметилового эфира кальцеина в течение 15-30 минут при 37 ° C, а затем промывали PBS. Для удаления внеклеточного железа добавляли 100 мкМ десфериоксамина, конъюгированного с крахмалом (DFO; щедрый подарок Biomedical Frontiers, Inc., Миннеаполис, Миннесота).Флуоресценцию измеряли при возбуждении 485 нм и эмиссии 535 нм с помощью считывающего устройства для флуоресцентных планшетов (BioTek Synergy 2). После стабилизации сигнала флуоресценции добавляли изоникотиноилсалицилальдегидгидразин (SIH) в конечной концентрации 10 мкМ для удаления железа из кальцеина, вызывая уменьшение гашения. Изменение флуоресценции после добавления SIH (ΔF) использовалось как косвенная мера пула лабильного железа. Эксперименты проводили в трех повторностях по 8 повторов на точку; данные представлены в виде средних значений со стандартными отклонениями.

Электронная микроскопия

Клетки фиксировали в 2,5% глутаральдегиде в какодилатном (0,1 М) буфере и затем фиксировали 1% тетроксид осмия / 0,8% феррицианид / какодилатный буфер (0,1 М). После дегидратации и заделки в эпоксидную смолу получали ультратонкие (70 нм) срезы, окрашивали уранилацетатом и цитратом свинца Сато и исследовали с помощью Hitachi H-7650 TEM. Энергодисперсионная рентгеновская спектроскопия (EDS) была выполнена на JEOL 2100 TEM, оборудованном полюсным наконечником высокого разрешения и детектором JEOL EDS.

Количественная оценка электронной плотности и ширины крист на микрофотографиях ПЭМ

Для количественной оценки электронной плотности митохондриального матрикса значения серого цитозольного матрикса вычитали из значений серого цвета митохондриального матрикса с использованием программного обеспечения ImageJ (NIH). Количественную оценку ширины крист выполняли путем измерения ширины поперечного сечения отдельных крист с использованием программного обеспечения ImageJ (NIH). Было проанализировано 10 или более клеток.

Статистика

Эксперименты проводились как минимум в трех повторностях (биологические повторения) с 3–8 техническими повторностями на точку.Достоверность оценивалась с помощью двустороннего t-критерия Стьюдента, при этом p ≤ 0,05 принималось как значимое. Фактические значения p для каждого эксперимента показаны на рисунках.

Заявление о совместном использовании данных

За исходными данными обращайтесь к соответствующему автору.

Toyota 1,3 16V (4E-FE / 4E-FTE) / Распредвалы Performance | Новые распредвалы | 1.3 16V 4E-F (T) E | Toyota | Производительность распредвалов | Двигатель и клапанный механизм | dbilas dynamic

Комплект распредвалов Toyota

Starlet (P9) / Corolla (E10) 1,3 16 V (двигатель 4E - FE и 4E - FTE)

Приложение: Rallye

Продолжительность: 288
Пиковая синхронизация: 106
Высота подъема клапана: 11,0
Высота подъема в ВМТ: 2,8 / 2,4
Время клапана: 38/70 - 70 / 38
Зазор клапана:: 20/30

Внимание! Особый дизайн, исключен из обмена.


Некоторая информация о нашей программе для распределительных валов.

Для облегчения выбора мы выбрали четыре разные категории распределительных валов. Категории показывают наши рекомендации по области применения автомобиля.

Road: Этот тип кулачка разработан для установки в стандартный дорожный автомобиль. Никаких других модификаций не требуется.

Sport: этот тип кулачка разработан для спортивного водителя. Мы рекомендуем использовать отрегулированный чип.

Ралли: Этот тип кулачка разработан для автомобилей, участвующих в раллийных или слаломных соревнованиях.Мы рекомендуем использовать сдвоенные карбюраторы или системы впрыска с несколькими дросселями с этим типом кулачка.

Овальная гусеница: этот тип кулачка разработан для автомобилей для длительных гонок, скалолазания и соревнований по драгстерам.

В принципе, все распредвалы есть на складе и готовы к отправке.

Для некоторых распределительных валов требуются усиленные пружины клапана. Для этого мы разработали комплекты пружин клапана из высококачественных материалов. Мы просим вас узнать о необходимости усиленных пружин клапана. Номер детали в разделе «Комплект пружин» включает в себя все необходимые детали, такие как подшипники, седла пружины и т. Д.Отдельные компоненты могут быть поставлены по запросу.

При заказе укажите полные данные об автомобиле и о том, для чего он будет использоваться, например, дорога, ралли, овальная трасса и т. Д.

При замене распределительного вала не забудьте также заменить все детали, которые соприкасаются с ним (например, опрокидывающий рычаг, толкатели, регулировочные пластины клапана), чтобы гарантировать, что поверхность распределительного вала не будет повреждена. Предлагаем опускные рычаги из улучшенных материалов специально для распредвалов Opel-OHC.

Все распредвалы поставляются с точным руководством по установке и данными и, если не указано иное, должны быть встроены, как стандартные распредвалы.

Мы не собирались перечислять все автомобили по именам, чтобы избежать путаницы. Как было сказано в начале, мы можем переточить стандартные распредвалы почти для всех автомобилей в стране и за рубежом, если нет доступных заготовок.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *