Д245А технические характеристики: Д245А, Диод выпрямительный, СЗТП | купить в розницу и оптом

Содержание

Диод Д245 — DataSheet

Корпус диода Д245

 

Описание

Диоды кремниевые, диффузионные. Предназначены для преобразования переменного напряжения частотой до 1,1 кГц. Выпускаются
в металлостеклянном корпусе с жесткими выводами. Тип диода и схема соединения электродов с выводами приводятся на корпусе.
Масса диода с комплектующими деталями не более 18 г.

Пои креплении диодов усилие затяжки должно быть не более 1,96 Н·м (0,2 кгс·м). При этом запрещается прилагать к изолированному выводу усилие, превышающее 9,8 Н (1 кгс), так как это может привести к нарушению целостности стеклянного изолятора.

Размеры радиатора (теплоотвода) рассчитываются из условия, что диод является точечным источником теплоты, рассеивающим мощность 2Uпр.срIпр.ср.

При последовательном соединении диодов рекомендуется применять диоды одного типа и шунтировать каждый резистором сопротивлением 10…15 кОм на каждые 100 В амплитуды обратного напряжения.

 

Характеристики диода Д245
Параметр Обозначение Маркировка Значение Ед. изм.
Аналог Д245 1N2023
Д245Б 1N1062
Максимальное постоянное обратное напряжение. Uo6p max, Uo6p и max Д245 300 В
Д245А 300
Д245Б 300
Максимальный постоянный прямой ток. Iпp max, Iпp ср max, I*пp и max Д245 10 А
Д245А 10
Д245Б 5
Максимальная рабочая частота диода fд max Д245 1.1 кГц
Д245А 1.1
Д245Б 1.1
Постоянное прямое напряжение Uпр не более (при Iпр, мА) Д245 1.25 (10 А) В
Д245А 1 (10 А)
Д245Б
1.5 (5 А)
Постоянный обратный ток Iобр не более (при Uобр, В) Д245 3000 (300) мкА
Д245А 3000 (300)
Д245Б 3000 (300)
Время обратного восстановления — время переключения диода с заданного прямого тока на заданное обратное напряжение от момента прохождения тока через нулевое значение до момента достижения обратным током заданного значения tвос, обр Д245 мкс
Д245А
Д245Б
Общая емкость
Сд (при Uобр, В)
Д245 пФ
Д245А
Д245Б

Описание значений со звездочками(*) смотрите в буквенных обозначениях параметров диодов.

Зависимость допустимого прямого тока от температуры

Зависимость среднего прямого тока от частоты

Если вы нашли ошибку, пожалуйста, выделите фрагмент текста и нажмите Ctrl+Enter.

Д242а технические характеристики двигатель — Авто журнал kupim-avto57.ru

Диод Д242, Д242А, Д242Б, Д243, Д243А, Д245, Д245А, Д246, Д247, Д248

справочник по диодам

  1. Кремниевыевыпрямительные диоды Д242, Д242А, Д242Б Д243, Д243А, Д243Б Д244, Д244А, Д244Б Д245, Д245А, Д245Б Д246, Д246А, Д246Б Д247, Д247Б Д248Б
  2. Габаритный чертеж:
  3. Электрические параметры:
  4. Предельныеэксплуатационные данные:
  5. Примечания:
  6. Графики:
  7. Дизельный двигатель Д-242
  8. Описание
  9. Аналоги транзистора КТ815
  10. (495) 761-82-04
  11. Характеристики диода Д242
  12. Устройство Д-242
  13. Основные технические характеристики диодов Д242, Д242А, Д242Б:
  14. Смотрите также:
  15. Аналоги тиристора КУ 202

Общие характеристики выпрямительных диодов.

В зависимости от значения максимально допустимого прямого тока выпрямительные диоды разделяются на диоды малой, средней и большой мощности:

малой мощности рассчитаны для выпрямления прямого тока до 300mA;
средней мощности – от 300mA до 10А;
большой мощности — более 10А.

По типу применяемого материала они делятся на германиевые и кремниевые, но, на сегодняшний день наибольшее применение получили кремниевые выпрямительные диоды ввиду своих физических свойств.

Кремниевые диоды, по сравнению с германиевыми, имеют во много раз меньшие обратные токи при одинаковом напряжении, что позволяет получать диоды с очень высокой величиной допустимого обратного напряжения, которое может достигать 1000 – 1500В, тогда как у германиевых диодов оно находится в пределах 100 – 400В.

Работоспособность кремниевых диодов сохраняется при температурах от -60 до +(125 — 150)º С, а германиевых – лишь от -60 до +(70 – 85)º С. Это связано с тем, что при температурах выше 85º С образование электронно-дырочных пар становится столь значительным, что происходит резкое увеличение обратного тока и эффективность работы выпрямителя падает.

Зарядка аккумулятора автомобиля своими руками

Внезапно разрядившийся аккумулятор никогда не прибавляет оптимизма, а автомобильный и подавно. Просто так ничего не случается, если бы аккумулятор умел говорить, он многое рассказал бы своему хозяину, который довел его до разрядки. Раз уж так случилось, то нужно заряжать, но с толком и с расстановкой, поскольку убить аккумулятор просто, а новая батарея вещь не дешевая.

Содержание:

Когда заряжать?

Сам процесс зарядки не вызывает никаких сложностей при соблюдении некоторых условий и наличии некоторых приборов при правильном их подключении некоторыми клеммами. Эту задачу с тремя неизвестными попробуем решить вместе, чтобы зарядка аккумулятора автомобиля своими руками не вызывала больше никаких вопросов.

Идеальными условиями работы аккумуляторной батареи считается его нормальное функционирование, разрядка, подзарядка внутри бортовой электросети автомобиля. Подзарядка от внешнего устройства необходима только тогда, когда аккумулятор находится или в критическом состоянии, или при экстремальных условиях использования. Выражаясь по-человечески, аккумулятор сам знает, когда ему заряжаться и когда и сколько тратить энергии. Наше дело – следить за показаниями амперметра и обеспечивать нормальную и стабильную работу бортовой сети.

Часто бывает такое, что на АКБ возложено слишком много задач во время стоянки машины – прослушивание любимой композиции в хорошей компании может затянуться надолго и это приведет к разрядке батареи, что сделает невозможным нормальный пуск двигателя. Температура воздуха очень влияет на способность АКБ держать емкость. После морозной ночи пуск холодного мотора может быть осложнен застывшим маслом и прокрутить его у батареи может не хватить сил. Тем более, если она не первой свежести. Тогда тоже спасет только зарядка. Перечислять все возможные случаи разрядки АКБ и халатности водителей мы не станем, а сразу перейдем к рассмотрению вопроса о том, какие бывают зарядные устройства.

Виды зарядных устройств

В тонкостях этого, на первый взгляд, простого вопроса можно погрязнуть с головой, и чтобы вас не путать, скажем, что аккумуляторы бывают

  • обслуживаемые;
  • необслуживаемые;
  • сухозаряженные;
  • залитые;
  • свинцово-кислотные;
  • гелевые.

Желательно быть в курсе, какой из видов АКБ стоит на вашем автомобиле, тогда можно точно выбрать способ ее зарядки. Поскольку разбор всех видов аккумуляторов может занять не один час, то мы посвятим этому отдельный разговор. Сейчас наша задача — подобрать зарядку. А бывают они всего двух типов – предпусковые устройства и пускозарядные. Предпусковые в свою очередь делятся на:

  • трансформаторные ЗУ;
  • импульсные ЗУ.

Трансформаторные зарядные устройства

Трансформаторные устройства потихоньку доживают свой век, так как они очень тяжелые и габаритные. Принцип их работы сводится к тому, что они передают напряжение бытовой сети аккумулятору для зарядки, преобразуя при этом переменный в постоянный ток и понижая напряжение до 10 – 14 вольт. Такие устройства работают на основе мощных трансформаторов, они очень надежные и альтернативы им нет. При стационарном использовании. Перемещению они подвергаются, но с трудом, так как могут весить до 30 кг в сборе.

Импульсные зарядные устройства

Более современными и мобильными считаются импульсные зарядные устройства. Они оборудованы защитными механизмами и схемами, которые значительно упрощают нам жизнь – такие ЗУ имеют индикаторы короткого замыкания, не позволят нарушить полярность подключения аккумулятора, имеют целый список разных дополнительных контрольных и автоматических функций. Стоит импульсное устройство значительно дешевле, чем трансформаторное, поэтому и получило более широкое применение.

Простейшее зарядное устройство

Зарядные устройства для автомобильных аккумуляторов стоят не очень дорого, если они китайские. Купив такую игрушку по бросовой цене, вы ее спишете на берег после третьего использования. Поэтому мы предлагаем сделать очень простое зарядное устройство своими руками.

Для этого нам потребуется силовой трансформатор от старого лампового телевизора, четыре диода Д242А, которые рассчитаны на 10 А, радиаторы для диодов и немного терпения. Вот схема зарядного устройства:


А вот нехитрая «распиновка» трансформатора:

Схема настолько проста, что не требует дополнительных пояснений. Разве что на выходе можно поставить амперметр, регулятор тока зарядки и контрольную лампочку на 12 вольт мощностью до 60 Вт. Тогда схема будет выглядеть так:


Для правильной зарядки аккумуляторной батареи теперь у нас есть все, осталось только внимательно все подключить, соблюдая при этом требования техники безопасности.

Блок питания усилителя TDA7294

Для питания усилитель с нагрузкой 4 Ома питание должно составлять 27 вольт, при сопротивлении динамиков 8 Ом напряжение должно быть уже 35 вольт.

Блок питания для усилителя TDA7294 состоит из понижающего трансформатора Тр1 имеющего вторичную обмотку на 40 вольт (50 вольт при нагрузке 8 Ом) с отводом посередине либо две обмотки по 20 вольт (25 вольт при нагрузке 8 Ом) с током нагрузки до 4 ампер. Диодный мост должен отвечать следующим требованиям: прямой ток не менее 20 ампер и обратное напряжение не менее 100 вольт. С успехом диодный мост можно заменить четырьмя выпрямительными диодами с соответствующими показателями.

Электролитические конденсаторы фильтра C3 и C4 предназначены в основном для снятия пиковой нагрузки усилителя и устранению пульсации напряжения идущего с выпрямительного моста. Данные конденсаторы обладают ёмкостью 10000 мкф с рабочим напряжением не менее 50 вольт. Неполярные конденсаторы (пленочные) C1 и C2 могут быть емкостью от 0,5 до 4 мкф с напряжением питания не менее 50 вольт.

Нельзя допускать перекосов напряжения, напряжение в обоих плечах выпрямителя обязательно должно быть равным.

Скачать datasheet на tda7294 (1,2 MiB, скачано: 5 547)

голоса

Рейтинг статьи

Двигатель д-242-56 (сварочные агрегаты) ммз — д-242-56м

Дополнительное описание

Двигатель ММЗ Д-242-56 предназначен для автономных сварочных агрегатов.

Основные технические характеристики:
— Мощность: 62 л.с.
— Масса, кг: 420
— Со стартером и генератором 12В, без пневмокомпрессора.

Технические характеристики:

  • Номинальная мощность двигателя, кВт (л.с.): 45,6 (62)
  • Тип двигателя: дизельный, четырёхтактный
  • Охлаждение: жидкостное
  • Частота вращения, об/мин: 1500 (1800)
  • Количество цилиндров: четырёхцилиндровый, рядный
  • Максимальный крутящий момент, Н·м: 241
  • Рабочий объём, л: 4,75
  • Запуск: электростартерный
  • Топливо: дизельное сезонное: Л-0,5-40 — летнее; 3-0,5 минус 35; 3-0,5 минус 45 — зимнее
  • Удельный расход топлива, гр/кВт·ч: 226
  • Масло: моторное для дизельных двигателей, сезонное: М10Г2 — летнее, М8Г2 — зимнее
  • Удельный расход масла, гр/кВт·ч: 2,4
  • Габаритные размеры, мм: 815×735×925
  • Масса сухого двигателя, кг: 430
  • Бортовой генератор: 14В, 700 Вт
  • Маркировка электростанции с данным двигателем: АД 30

Кремниевые выпрямительные диоды Д242, Д242А, Д242Б Д243, Д243А, Д243Б Д244, Д244А, Д244Б Д245, Д245А, Д245Б Д246, Д246А, Д246Б Д247, Д247Б Д248Б

Диоды кремниевые
диффузионные.
Предназначены для преобразования
переменного напряжения с частотой
до 1,1 кГц в постоянное.
Корпус металлостеклянный с
жесткими выводами.
Обозначение типа и схема
соединения электродов с выводами
приводятся на корпусе.
Масса диода не более 12 г. (Масса с
комплектующими деталями 18 г.).

Электрические параметры:

Тип
прибора
Предельные
значения
параметров при Т=25С
Значения
параметров
при Т=25С
Тк.макс
(Тп.)
С
Uобр.макс.
(Uобр.и.макс.)
B
Iпр.макс.
(Iпр.и.макс.)
A
Iпрг.
A
fраб.
(fмакс.)
kГц
Uпр.
B
при
Iпр.
A
Iобр.
mA
Д242(100)10,02 (10)1,2510,03,0130
Д242 А(100)10,02 (10)1,010,03,0130
Д242 Б(100)5,02 (10)1,55,03,0130
Д243(200)10,01,11,2510,03,0130
Д243 А(200)10,01,11,010,03,0130
Д243 Б(200)5,01,11,55,03,0130
Д244(50)10,01,11,2510,03,0130
Д244 А(50)10,01,11,010,03,0130
Д244 Б(50)5,01,11,55,03,0130
Д245(300)10,01,11,2510,03,0130
Д245 А(300)10,01,11,010,03,0130
Д245 Б(300)5,01,11,55,03,0130
Д246(400)10,01,11,2510,03,0130
Д246 А(400)10,01,11,010,03,0130
Д246 Б(400)5,01,11,55,03,0130
Д247(500)10,01,11,2510,03,0130
Д247 Б(500)5,01,11,55,03,0130
Д248 Б(600)5,01,11,55,03,0130
Uобр.макс.максимально-допустимое
постоянное обратное
напряжение диода;
Uобр.и.макс.максимально-допустимое
импульсное обратное
напряжение диода;
Iпр.макс.максимальный средний
прямой ток за период;
Iпр.и.макс.максимальный импульсный
прямой ток за период;
Iпрг.ток перегрузки
выпрямительного диода;
fмакс.максимально-допустимая
частота переключения диода;
fраб.рабочая частота
переключения диода;
Uпр. при Iпр.постоянное прямое
напряжения диода при токе Iпр;
Iобр.постоянный обратный ток
диода;
Тк.макс.максимально-допустимая
температура корпуса диода.
Тп.макс.максимально-допустимая
температура перехода диода.

Предельные


эксплуатационные данные:

Примечания:

1. Допускается
трехкратная перегрузка по среднему
току в течение 0,5 сек.

2. При креплении диодов к
теплоотводу усилие затяжки должно
быть не более 1,96 Н*м. Категорически
запрещается при монтаже прилагать
к изолированному выводу усилие,
превышающее 9,8 Н, что может привести
к нарушению целостности
стеклянного изолятора.

3. Теплоотводящий
радиатор может быть рассчитан из
условия, что диод является точечным
источником тепла, рассеивающим
мощность 2Uпр.,ср. * Iпр.,ср.

4. При последовательном
соединении диодов с целью
увеличения выпрямленного
напряжения рекомендуется
применять диоды одного типа и
шунтировать каждый прибор
сопротивлением 10-15 кОм на каждые 100
В амплитуды обратного напряжения.

Графики:

Для диодов:
Д242, Д242 А, Д242 Б, Д243, Д243 А, Д243 Б,
Д245, Д245 А, Д245 Б, Д246, Д246 А, Д246 Б,
Д247, Д247 Б, Д248 Б
 
Для диодов: Д242, Д242 А,
Д242 Б

Возврат к оглавлению
справочникаНа Главную страницу
www.5v.ru

Recommended Posts

Для улучшения контакта работающих элементов с радиатором, нужно использовать теплопроводные пасты. Для этой цели и предназначается зарядные устройства.

Вольтметр РV1 — любой постоянного тока со шкалой на 16Вольт.

В схеме применяется транзистор с большим коэффициентом усиления Спасибо за ответ.

Вместо NE можно использовать российский аналог — таймер ВИ1. Оборудование предназначается для зарядки автомобильных аккумуляторов с напряжением 14,5 Вольт. Что же тогда тупит.

Самоделки, хобби, увлечения.

Включите устройство зарядное в сеть, при этом должен включиться индикатор. Поискав в интернете, наткнулся на промышленную схему зарядного устройства с регулирующими тиристорами.

Устройство УЗ-ПА имеет плавную установку зарядного тока, электронную схему защиты, обеспечивающую сохранность аккумуляторной батареи при перегрузках, коротких замыканиях и неправильной полярности подключения выходных зажимов. Время, за которое конденсатор С1 будет заряжаться до переключения транзистора, выставляется переменным резистором R7, которым, собственно, и выставляется величина зарядного тока аккумулятора.

‘).f(b.get(,!1),b,»h»,).w(«

Длительность бестоковой паузы зависит от степени заряженности аккумуляторной батареи. Этот режим позволяет не только восстанавливать засульфатированные батареи аккумуляторов, но и проводить профилактическую обработку исправных. Время, в течение которого конденсатор С1 заряжается до переключения можно регулировать переменным резистором R1

Обратите внимание, что в схеме стоит тиристор КУ, он немного слабоват, поэтому чтобы не допустить пробоя импульсами большого тока его необходимо установить на радиатор

А Для подзарядки применяется напряжение сети в В. Восстановление и зарядка аккумулятора.
Зарядное устройство на тиристоре

Первым диодом, который мы сегодня опишем, является диод Д 242.

Данный диод отечественного производства. Изготавливается в России. Имеет пропускную способность в 100 В при скорости в 1,1 кГц. Данный диод может преобразовать лишь 100 В., то есть всего 10 А постоянного напряжения.

Если данный диод напрямую подключить к розетке в 220 В, то пропускной мощности диода, скорее всего не хватит и сгорит, даже может расплавиться. Скорость в 1,1 кГц является весьма низкой, то есть могут быть скачки напряжения. Но, так или иначе, если, к примеру, ставить 2 или 3 таких диода, то и преобразование тока и пропускная способность будут весьма приличными.

Хотя на деле обычно так и происходит. Данный диод весит всего 18 г и выполнен в металлическом корпусе с жёсткими прочными выводами. Также имеет аналог, то есть в случае отсутствии диода д 242 его можно заменить диодами д 243, д 245 и д 246.

Статьи о товаре

Самостоятельная диагностика и типичные неисправности дизельных двигателей

Автомобили с дизельными двигателями завоевывают все большую популярность. Есть множество причин, которыми руководствуются автовладельцы при покупке авто именно с дизельным мотором. При этом нужно учитывать, что любая техника может дать сбой и потребуется ее восстановление. Ремонт дизельного двигателя имеет свои особенности по сравнению с бензиновым.
ах

Пригорание или заклинивание клапанов в седлах

Разрушение пружин клапанов

В холодное время года — неисправность свечей накаливания

Поломка ТНВД

Двигатель запускается, но через несколько секунд глохнет
Нарушение герметичности топливных магистралей

Засорение выпускной системы двигателя

Поломка ТНВД

Критическое засорение топливных фильтров

Двигатель глохнет при повышении нагрузки
Попадание в топливо воды

Поломка ТНВД

Засорение фильтра тонкой очистки топлива

Двигатель глохнет без видимых причин
Непроходимость топливопроводов из-за чрезмерного засорения

Поломка топливопроводов

Двигатель глохнет при перегрузке
Заклинивание поршня в цилиндре

Заклинивание коленчатого вала

Разрушение шатунов поршней

В тракторах — выход из строя подшипников вала отбора мощности

Проворачивание вкладышей

Двигатель работает неравномерно, его мощность снижена, светлый выхлоп
Поломка ТНВД

Засоре

Основные неисправности, рекомендации по эксплуатации и обслуживанию двигателей

Двигатель — один из самых важных и сложных агрегатов в автомобиле. Современные моторы очень надежны и эффективны, однако в них под воздействием механических и тепловых нагрузок, а также по другим причинам могут возникать различные неисправности. О поломках бензиновых и дизельных двигателей, их причинах и способах устранения рассказано в данной статье.
оплива с помощью рычага на бензонасосе. Достаточно нажать на рычаг 7-8 раз, если накачать бензина больше, то он зальет свечи и запустить двигатель будет еще сложнее;
Полностью вытянуть ручку управления воздушной заслонкой карбюратора — заслонка, перекрывая первую камеру карбюратора, снижает поступление воздуха, чем обеспечивается обогащение горючей смеси;
Выключить сцепление (до упора нажать педаль сцепления), педаль газа во время пуска не стоит трогать;
Повернуть ключ зажигания до упора вправо, произвести пуск. Обычно двигатель запускается через 7-10 секунд, если же этого не произошло в течение 15 секунд, то нужно выключить зажигание, подождать 30-60 секунд, и снова повторить попытку. При успешном запуске необходимо дать прогреться мотору в течение нескольких минут, в это время оборотами двигателя можно управлять с помощью дроссельной заслонки. Обычно во время прогрева обороты несколько повышены (до 2000 об/мин), но чрезмерного превышения (в

Двигатели SOHC и DOHC: два против одного

Выбирая новый автомобиль, покупатель может столкнуться с необычной на первый взгляд задачкой: взять машину с двигателем SOHC или DOHC? О том, что означают эти аббревиатуры, чем отличаются эти двигатели, и какие они имеют преимущества и недостатки — читайте в данной статье.
ебольших легковых автомобилях. Однако разные схемы SOHC имеют свои достоинства и недостатки. Так, моторы с коромыслами легко поддаются регулировке, но при этом не обеспечивают высоких показателей мощности. Двигатели с рычагами создают много шума, да еще и не слишком надежны. А моторы с толкателями наиболее просты, но создают некоторые сложности с регулировками.

Преимущество двигателей DOHC заключается в том, что они позволяют более точно установить фазы ГРМ, а в случае четырех и более клапанов на цилиндр обеспечивают высокую мощность и обладают более высокой надежностью. Показатели мощности возрастают из-за лучшего перемешивания и сгорания топливно-воздушной смеси. А надежность повышается за счет того, что увеличение количества клапанов позволяет снизить массу каждого из них, а значит, клапаны могут двигаться быстрее, создавая меньше нагрузок на пружину и седло. Так что, как ни странно, кажущийся на первый взгляд более сложным двигатель DOHC на деле оказывается более простым и надеж

Все статьи

Следующий диод в нашем списке это 1N4007.

Он является самым распространенным среди всех остальных диодов. Данный диод уже импортный и выпускается в США. Возможно, он приобрёл свою популярность именно потому, что его ставят на блоки питания всей импортной бытовой аппаратуры. Так как на российском рынке практически не осталось отечественной электроники, то он, разумеется, будет самым используемым.

Но помимо этого его также «любят» и за высокие характеристики, которые откровенно говоря, в разы превосходят отечественные диоды. Данный диод выпускается уже в пластиковом корпусе, что делает его более устойчивым к влажности и воздействию воды. Массу его весьма сложно определить, так как он практически «пушинка» в руке.

Имея такую низкую массу, данный диод имеет пропускную способность в 1000 В. Данный диод будет пропускать самое чистое напряжение, которое может быть. Учитывая его пропускную способность в наше время, он является самым устойчивым к перепадам напряжения. Так же хочется сказать, что данный диод является самым современным.
На этом, пожалуй, всё. Как видно иностранные диоды весьма превосходят отечественные диоды во всех смыслах. Но это уже не от того что отечественные электронщики не могут придумать диод, а скорее от того что после распада Советского Союза сфера электроники очень сильно затормозилась, если не остановилась совсем. Хотя может быть и такое что отечественная электроника работает только для «самих себя», то есть в узком направлении выпускает ту или иную продукцию, которая не будет использоваться обычным потребителям, например оборонная и сталелитейная промышленность.

Пишите комментарии, дополнения к статье, может я что-то пропустил. Загляните накарту сайта, буду рад если вы найдете на моем сайте еще что-нибудь полезное.

Диод N4007

Кремниевый диод малой мощности в пластиковом корпусе модели DO-41.

Весьма часто применяется, чтобы сформировать блок питания (как компонент  выпрямителя, включающего в себя 4 диода).  Как и прочие модели, предназначен для преобразования характера напряжения (был переменным, становится постоянным). Выпускаются диоды подобного образца преимущественно в Тайване компаниями DIODES и RECTRON SEMICONDACTOR. В иных зарубежных странах изготовители тоже есть, но объём поставок от них невелик.

Массово применяется в телефонах, смартфонах, планшетных компьютерах.

Для самых недорогих маломощных (до 1 Ватта) устройств достаточно всего одного такого диода (вместо моста из 4-х). Чтобы легче ориентироваться при установке, на покрытии имеется выделенное цветном кольцо, обозначающее расположение катодного вывода.

Длина вывода на каждой стороне диода достаточна как для горизонтального расположения, так и для вертикальной установки. Имеет низкую себестоимость. Почти все полупроводники серии 1N4001 — 1N4007 возможно заменить на 1N4007 при необходимости. Мажет применяться в радиоаппаратуре вместо варикапа.

Постоянное обратное напряжение (max.) — 1000 В

Постоянный ток (max.) — 1 А (при 75°C)

Прямое напряжение (max.) — 1,1 В

Рабочая температура — -65…+175°C

Вес — 0,33 г

Аналоги

  • Российские:
  • КД243ж;
  • КД258д.
  • Зарубежные:
  • HEPR0056RT;
  • BYW43;
  • 1N2070, 1N3549;
  • BY156, BYW27.

Дополнительное описание

ММЗ Д-242-600 — это надёжный в эксплуатации, экономичный дизельный двигатель. Обладает повышенным ресурсом в эксплуатации (в 2 раза больше) по сравнению с бензиновыми аналогами.

Применяемость:

Тракторы МТЗ, автобетоносмесители Tigarbo, автобетоновозы, экскаваторы, самоходные погрузчики контейнеров, погрузчики, тракторы ЮМЗ, передвижные компрессорные станции, сварочные агрегаты.

Технические характеристики:

  • Модель: Д-242-600
  • Число и расположение цилиндров: 4, рядное, вертикальное
  • Тип системы газообмена: без турбонаддува
  • Номинальная мощность, кВт (л.с.): 45,6 (62)
  • Номинальная частота вращения, об/мин: 1800
  • Максимальный крутящий момент, Н·м (кгс·м): 278 (28,3)
  • Частота вращения при максимальном крутящем моменте, об/мин: 1400
  • Удельный расход топлива, г/кВт·ч (г/л.с.·ч): 226 (166)
  • Масса, кг: 413-473
  • Габаритные размеры, мм: 1255х683х993

Диод Д242

Диффузионный полупроводник. Изготовлен из кремния и «упакован» в металлостекляный корпус. Выводы жёсткие. На поверхности обозначены тип и цоколевка (отображение взаиморасположения электродов и выводов). Д242 относится к числу выпрямительных среднемощных диодов, то есть он рассчитан на выпрямление тока от 300mA до 10А. Применяется в различных сферах радиоэлектронной промышленности.

Постоянное обратное напряжение (max.) — 100 В

Постоянный прямой ток (max.) — 10 А

Прямое напряжение (mid.) — 1,25 В

Рабочая температура — -65…+130°C

Обратный ток (mid.) — не более 3 mA

Граничная частота — 1 кГц

Вес (со всеми дополняющими) — 18 г

Вес (только диод) — 12 г

Модификации: Д242а, Д242б

Аналоги: Д243, Д245, Д246

Параметры тиристора КУ 202

ПараметрОбозначениеЕди-
ница
Тип тиристора
КУ202АКУ202БКУ202ВКУ202Г
Постоянный ток в закрытом состоянииIз. смА10101010
Постоянный обратный ток при Uобр maxIобрмА10101010
Отпирающий постоянный ток управленияIу. отмА200200200200
Отпирающее постоянное напряжение управленияUу. отВ7777
Напряжение в открытом состоянииUосВ1,51,51,51,5
Неотпирающее постоянное напряжение управленияUу. нотВ0,20,20,20,2
Время включенияtвклмкс10101010
Время выключенияtвыклмкс150150150150
Предельно допустимые параметры      
Постоянное напряжение в закрытом состоянииUз. с maxВ25255050
Постоянное обратное напряжениеUобр maxВ
Постоянное обратное напряжение управленияUу. обр maxВ10101010
Минимальное прямое напряжение в закрытом состоянииUз. с minВ
Постоянный ток в открытом состоянииIос minА10101010
Импульсный ток в открытом состоянииIос. и minА50505050
Постоянный прямой ток управленияIу maxА
Импульсная рассеиваемая мощность УЭPу. и maxВт
Средняя рассеиваемая мощностьPср maxВт20202020
Максимальная температура окружающей средыTmax°С+85+85+85+85
Минимальная температура окружающей средыTmin°С-60-60-60-60
ПараметрОбозначениеЕди-
ница
Тип тиристора
КУ202ДКУ202ЕКУ202ЖКУ202И
Постоянный ток в закрытом состоянииIз. смА10101010
Постоянный обратный ток при Uобр maxIобрмА10101010
Отпирающий постоянный ток управленияIу. отмА200200200200
Отпирающее постоянное напряжение управленияUу. отВ7777
Напряжение в открытом состоянииUосВ1,51,51,51,5
Неотпирающее постоянное напряжение управленияUу. нотВ0,20,20,20,2
Время включенияtвклмкс10101010
Время выключенияtвыклмкс150150150150
Предельно допустимые параметры      
Постоянное напряжение в закрытом состоянииUз. с maxВ1201201010
Постоянное обратное напряжениеUобр maxВ240240
Постоянное обратное напряжение управленияUу. обр maxВ1010
Минимальное прямое напряжение в закрытом состоянииUз. с minВ
Постоянный ток в открытом состоянииIос minА10101010
Импульсный ток в открытом состоянииIос. и minА50505050
Постоянный прямой ток управленияIу maxА
Импульсная рассеиваемая мощность УЭPу. и maxВт
Средняя рассеиваемая мощностьPср maxВт20202020
Максимальная температура окружающей средыTmax°С+85+85+85+85
Минимальная температура окружающей средыTmin°С-60-60-60-60
ПараметрОбозначениеЕди-
ница
Тип тиристора
КУ202ККУ202ЛКУ202МКУ202Н
Постоянный ток в закрытом состоянииIз. смА10101010
Постоянный обратный ток при Uобр maxIобрмА10101010
Отпирающий постоянный ток управленияIу. отмА200200200200
Отпирающее постоянное напряжение управленияUу. отВ7777
Напряжение в открытом состоянииUосВ1,51,51,51,5
Неотпирающее постоянное напряжение управленияUу. нотВ0,20,20,20,2
Время включенияtвклмкс10101010
Время выключенияtвыклмкс150150150150
Предельно допустимые параметры      
Постоянное напряжение в закрытом состоянииUз. с maxВ10101010
Постоянное обратное напряжениеUобр maxВ360360480480
Постоянное обратное напряжение управленияUу. обр maxВ
Минимальное прямое напряжение в закрытом состоянииUз. с minВ
Постоянный ток в открытом состоянииIос minА10101010
Импульсный ток в открытом состоянииIос. и minА50505050
Постоянный прямой ток управленияIу maxА
Импульсная рассеиваемая мощность УЭPу. и maxВт
Средняя рассеиваемая мощностьPср maxВт20202020
Максимальная температура окружающей средыTmax°С+85+85+85+85
Минимальная температура окружающей средыTmin°С-60-60-60-60

Следующий в списке диод Д 226.

Это диод уже другой. Он имеет сплавной. Корпус состоит уже с металло-стеклянных материалов. Его пропускная способность и напряжение в разы выше двух предыдущих диодов. Он пропускает через себя 300 В переменного тока. Если сравнивать с двумя предыдущими то диоды кд 202 в и д 242 пропускали через себя всего 100 в переменного тока, и на прибор к которому подключается 220 В ( то есть обычная розетка) их необходимо ставить минимум 3 таких диода.

Диод д226 способен в одиночку пропустить и преобразовать напряжение в 220 В. При этом стоит отметить, что при работе данного диода уже важна температура. Например, если при температуре от -60 С до +50 С он способен пропускать через себя 300 В, то уже от +50 С до +80 С он сможет пропустить лишь 250 В.

Оцените статью:

Трелевочный трактор ТЛТ-100

Современный трактор ТЛТ 100 – трелевочный агрегат на гусеничном ходу. Лесорубы используют такое название, как «сотка». Часто модели ТЛТ 100 называются «Онежец-120». Машина предназначена для трелевки хлыстов, различных видов деревьев, сортиментов, погрузки на платформу, перемещения к месту перегрузки. «Сотка» оборудована лебедкой, толкателем, платформой для транспортировки.

Сборку осуществляет ООО «Онежский трактор». Первые ТЛТ-100 сошли с конвейерных линий Онежского тракторного завода в 1997 году. Новые трелевщики заменили предыдущую модель трактора ТДТ-55.

Модификации ТЛТ-100

Производители реализуют несколько модификаций, базовую ТЛТ-100, а также ТЛТ-100А, 04, 06 трелевщики. Отличия между базовой моделью и «А» версией заключаются в разных моторах (СМД-20 или Д-245), а также весе (11.2 тонны или 11 тонн).

Машины модификаций 04-06 выпускались с улучшенной ходовой частью, модифицированным ведущим мостом. Ширина гусениц 04 модели составляет 48 сантиметров, 06 – 64 сантиметра. ТЛТ-100-04 весит 12.4 тонны, а ТЛТ-100-06 12.6 тонн. Ведущие мосты обеих моделей оснащены двухступенчатыми бортовыми передачами.

Ходовая система ТЛТ-100А-06 с широкими гусеницами, двухступенчатыми редукторами, большими ведущими колесами отличается повышенной проходимостью, позволяет использовать трактор в сложных условиях. Машина может передвигаться по неустойчивым грунтам, глубокому снегу.

Производительность модели ТЛТ-100-06, если сравнивать с базовой ТЛТ-100А увеличилась приблизительно на 30%. Снизился удельный расход горючего в пересчете на один хлыст на 20 и более процентов.

Принцип работы ТЛТ100

Благодаря гусеничному ходу самоходная установка легко передвигается по бездорожью, каменистой почве, болотистой местности. Подготовка и расчистка площадок, ремонт дорожного покрытия, перемещение хлыстов, деревьев выполняется толкателем.

Двигатель ТЛТ-100

На «сотки» с 1999 года устанавливается минский дизельный двигатель. Модель Д-245-16Л-522(-192) мощностью 122.4 л.с. оснащена турбонаддувом. Расход горючего составляет 210 г/кВтч. Топливный бак вмещает 140 литров.

Габариты ТЛТ-100

Длина трелевщика ТЛТ 100 с учетом переднего щита в транспортном положении составляет 6 метров, высота – 3, а ширина по крайним точкам гусениц – 2,575 метра. Дорожный просвет равен 55.5 сантиметрам, ширина колеи – 169 сантиметров. Ширина обеих гусениц зависит от модификации, варьируется от 44 до 64 сантиметров.

Технические характеристики ТЛТ-100

Самоходный трелевщик «Онежец-120» относится к третьему классу тяги. Трактор оборудован стыковочным узлом для подключения дополнительных устройств.

Возможно использование трактора с навесными, а также полунавесными агрегатами. Модификация ТЛТ-100-06 считается лучшей базой для сучкорезов, челюстных погрузчиков, пакетоподборщиков, другого оборудования, которому необходима высокая устойчивость.

Общая длина лебедки достигает 40 метров, а максимальная тяга – 105 килоньютонов. Предельный объем одного пакета при хвате за вершины составляет 10, а за комли – 8 кубических метров.

Диапазон возможных скоростей начинается с 2.83 и ограничивается 10.35 км/ч. Гидросистема оборудована надежным насосом модели НШ-32У-З-Л и баком емкостью 56 литров.

В модернизированной ходовой системе используются литые ведущие колеса с одиннадцатью зубьями. Расстояние между соседними зубьями составляет 13.4 сантиметра. Удельное давление на поверхность без размещенного груза не превышает 0,049 МПа.

Преимущества ТЛТ-100

ТЛТ-100А отличается от других моделей такими преимуществами, как

Высокая проходимость. Адаптированная ходовая система позволяет преодолевать препятствия и неровности поверхности, в том числе на каменистых участках.

Легкое управление. При передаче сигналов используются унифицированные раздельные гидроусилители.

Эргономичность. Одноместная кабина защищена каркасом безопасности, оборудована системой отопления, вентиляцией, гасителем вибраций, отличается высокой теплоизоляцией и шумоподавлением.

Надежность. Узлы трансмиссии, ходовой части, несущей системы трактора ТЛТ 100 выдерживают постоянные эксплуатационные нагрузки.

Экологичность. Широкие гусеничные тралы ТЛТ-100А–06 оказывают незначительное воздействие на лесные почвы.

Трелевочные тракторы «сотой» модели по технико-экономическим показателям не уступают зарубежным машинам. Двигатели всех модификаций собираются из качественных российских и белорусских комплектующих.

Габаритные размеры, мм
Длина 6 000
Ширина 2 575
Высота 3 000
Колея 1 690
Дорожный просвет 550
Масса, кг 11 200
Погрузочное устройство
Канатоемкость лебедки, м 40
Максимальное тяговое усилие лебедки 105
Максимальный объём трелюемого пакета, куб.м
За комли 8
За вершины 10
Двигатель
Марка Д-245-16Л-522, Д-245-16Л-192 Минский моторный завод
Мощность дизеля, кВт(л.с.) 88,2 (120)
Номинальная частота вращения, об/мин -1 1 800
Удельный расход топлива, г/л.с.ч. 167
Емкость топливного бака, л. 140
Трансмиссия
Тип Механическая
Коробка передач 5-ступенчатая с шестернями постоянного зацепления, 5 передач вперед, 1 назад.
Диапазон скоростей движения, км/ч
Механизмы поворота Многодисковые, сухого трения, постоянно замкнутые
Рабочий тормоз Два ленточных тормоза сухого трения на барабанах механизма поворота
Бортовые передачи Одноступенчатный  цилиндрический редуктор в неразъемном картере
Ходовая система
Ведущие колеса Одновенцовые литые
Число зубьев 11
Шаг зубьев, мм 134
Ширина гусеницы, мм 440
Наибольшее из средних удельных давлений на грунт (без груза) 0,049
Гидросистема технологического оборудования
Насос НШ-32У-3-Л на двигателе (НШ-50)
Емкость гидробака, л. 56
Электрооборудование
Номинальное напряжение, В 12
Генератор Со встроенным выпрямителем и блоком регулятора напряжения
Аккумуляторная батарея 6СТ75АМ
Стартер пускового двигателя СТ362А
Кабина
Каркас безопасности, отвечающий требованиям стандартов FOPS, POPS, OPS. Вибро-шумо-теплоизоляция, системы нормализации микроклимата в зимнее и летнее время.
Сиденье Полноповоротное подрессоренное
Эргономический пульт управления с обеспечением нормативных значений управляющих усилий.
Технические характеристики ТЛТ-100
Марка дизеля Д-245-16
Мощность дизеля, кВт (л.с.) 88(120)
Масса эксплуатационная, кг. 11200

Отзывы

Как считают трелевщики, трактор ТЛТ 100 – лучший по проходимости в заболоченном лесу. Маневренные машины без отказов работают в течение всего гарантийного периода, если своевременно проходить техническое обслуживание, заменять расходные материалы.

 Как приобрести оборудование

 Если необходимы трелевщики ТЛТ 100 купить тракторы вы можете, заполнив форму на сайте или позвонив менеджеру. Оборудование сертифицировано, представляется гарантия. Обращайтесь, для нас важен каждый заказчик!

Моноциклон Д 260, Д 245 (А.53.21.000 2),Производство и ремонт гидравлики

Ремонт Гидронасоса, 🥇, Запчасти к Насосам, ⚡️, Ремонт Насосов, ⭐️, Ремонт Гидромоторов, ✅, Ремонт Гидромоторов и Гидронасосов, 🔥, Ремонт Гидростатики, Ремонт Гидравлики, ➤  Запчасти A4VG, Запчасти Запчасти A4VSO, Запчасти A4V, Запчасти A10VSO, Запчасти A10VO, Запчасти A10V, Запчасти A10VNO, Запчасти A10VSNO, Ремонт роторной группы,  Ремонт роторной группы Бош,  Роторная группа,  Наладка и Регулировка Настроек. Система бронювання ремонту. Майданчик онлайн бронювання ремонту. Крос сервіс пошуку бронювання ремонту гідравліки. Можливість запису на ремонт щоб в призначення час наші фахівці Вас вже чекали! Ремонт гидронасоса, Виробництво та ремонт гідравліки, ремонт шестеренчатого насоса, ремонт гідророзподільника, Ремонт гідромотора, ремонт гидронасоса, Виробництво та ремонт гідравліки, ремонт шестеренчатого насоса, ремонт гідророзподільніка, Ремонт гідромотора. Мережа професіоналів по ремонту гідравліки. Соціальна мережа гідравлістов. Спільнота фахівців з відновлення та ремонт гидронасоса, ремонт гідромотора, ремонт гідророзподільника. Мережа професіоналів з гідравліки. Сервісна служба гідравлістов. Спільнота гідравлістов і фахівців з пневматики. Мережа фахівців з діагностики несправностей гідравлічних приводів. Виконавці з відновлення гідромеханізмів. BOSCH REXROTH A2FM, A2FE, A4FM, A10FM, A10FE, AZMB, AZMF, AZMN, AZMG, A2FO, A10VSO, A4VG, A4VSG, A4VSO, A8VO, A4FO, A11VO, A6VM, A7FO, MCR-A, MCR-C, MCR- D, MCR-E, MCR-F, MCR-H, MCR-R, MCR-T, MCR-W, MCR-X, A2F, A7V, A6VM, A7VO, 310.112, 310.56, 310, 210, 410, A4V, A10V, 310.2.28, Вceукpaінcкій реєстр cepвіcниx цeнтpoв, Ремонт Гідравліки з перших рук з швидкою доставкою, Досвід, Низькі ціни, Прямі руки, Без посередників. Система бронювання ремонту. Майданчик онлайн бронювання ремонту. Крос сервіс пошуку бронювання ремонту гідравліки. Мережа професіоналів по ремонту гідравліки. Соціальна мережа гідравлістов. Спільнота фахівців з відновлення та ремонт гидронасоса, ремонт гідромотора, ремонт гідророзподільника. Мережа професіоналів з гідравліки. Сервісна служба гідравлістов. Спільнота гідравлістов і фахівців з пневматики. Мережа фахівців з діагностики несправностей гідравлічних приводів. Виконавці з відновлення гідромеханізмів. Зaпішітecь в нaдeжний cepвіc пo фікcіpoвaннoй цeнe. Hікaкіx дoплaт і увeлічeнія cтoімocті ремонту. Нейронна мережа пошуку професіоналів. Машинне навчання пошуку фахівців для проведення якісного ремонту. Сервіс онлайн пошуку майстрів, онлайн пошук виробників, знайти виконавця, знайти фахівця, Онлайн-сервіс замовлення послуг, Перевірені часом фахівці для виконання ремонтних робіт по відновленню, капітального ремонту, Вашої спецтехніки, Ремонт гідравліки, Виконавці ремонту АКПП, Ремонт КПП, Ремонт, Реставрація , відновлення, капітальний ремонт, обслуговування, відновлення, Проект, Ревізія, Огляд, Цех, Виробництво та ремонт гідравліки, Виробник гідравліки, Виробництво гідромотора, Виробництво гидронасоса, Продаж, Обмін, Професійний, профільованих, ремонт, Реставрація КПП, ремонт коробок передач, ремонт коробки перемикання передач, ремонт механічної коробки передач, ремонт автоматичної коробки передач, Обмін, Обмінний фонд, Гарантії, Професійний ремонт, Деффектовка, Онлайн-сервіс замовлення якісних послуг, ремонт гидронасоса, ремонт гідромотора, Гідронасос, Коробка, Гидромотор, знайти, Реставрація гідравліки, якість, Порядність, Прозрачнос ть, Чесність, Виїзд, Бригада, Kabanchik, Спецтехніка, Деффектовка, Ремонт Гідронасоси, Ремонт гідромотори, Гіпермаркет гидронасоса, Гіпермаркет гідромоторами, Гіпермаркет, Стати фахівцем, Ремонт гідравліки для машин технічних служб, Ремонт розподільників в Україні, Ремонт гідроклапана, Ремонт гідроклапана, Гидрооборудование , Гідравліка Маніту, Золотник, Клапан, Записатися на ремонт, Записатися на ТО, Майданчик перевірених фахівців для виконання ремонтних робіт по відновленню, капітального ремонту, обслуговування Вашої спецтехніки. Будівельна техніка, Дорожня техніка, Транспортна техніка, Будівельного обладнання, Комунальної техніки, навантажувачі, бульдозери, Катка, екскаватора, Автокрана, навантажувачів, грейдерів, Кар’єрної техніки, Будівельної, Самоскида, Кузови, Підйому, Грейфера, Кран, Автогрейдера, Маніпулятора, зерновози , спецтехники, Причепа, Трактори, Техніка для прибирання вулиць, Запчастини для спецтехніки, Дорожньої, Навісне снігозбиральне обладнання, Харвестери, лісозаготівельних машин, Лісового Комбайна, спецтехники, Промислова оснащення, Верстати, Станочное обладнання.

Дизельный самосвал ГАЗ-3309: технические характеристики, устройство

Самым распространенным среднетоннажным грузовиком Советской эпохи являлся ГАЗ-53, он же по-народному – «Газон». После распада данный грузовик стал не рентабельным из-за значительного расхода топлива. Однако Горьковский автомобильный завод от производства среднетоннажных авто не отказался, хотя выпускаемые малотоннажные авто «ГАЗель», выпускаемые этим же заводом стали наиболее востребованы.

Самосвал ГАЗ-3309

Сменой модели ГАЗ-53 стал грузовик с обозначением ГАЗ-3307, с пересмотренной внешностью, некоторыми техническими характеристиками, но это был все тот же грузовик с 8-цилиндровым бензиновым агрегатом под капотом, у которого расход был значительный. Чуть позже завод наладит производство дизельных грузовиков, которые стали более приемлемы.

автомобиль ГАЗ-3309, как и предшественник, представляет собой классический грузовик с несущей рамой и задним приводом. Отличается от модели 3307 наличием дизельного агрегата минского производства Д-245, который применялся на тракторах МТЗ. Позже появилась еще и версия 33098 – турбодизелем Ярославского производства. Выпускается дизельный Газон Горьковским автозаводом и сейчас.

Дизельная версия ЗЗ09 производится с несколькими типами кузов: шасси, обычная бортовая грузовая платформа, цельнометаллический кузов, предназначенный для перевозки грузов и пассажиров, версия с самосвальным кузовом. На базе дизельного 3309 выпускается ряд автомобилей специального назначения.

Интересует же нас пока только самосвальная версия, поскольку она считается оптимальным авто для сельского авто. Отличается эта версия от 3309 с обычной грузовой платформы наличием гидравлической системы подъема кузова. Но самосвальная конструкция повлияла на размеры и грузоподъемность кузова.

Фото дизельного самосвала ГАЗ-3309

Устройство

По типу грузового кузова дизельный самосвал ГАЗ-3309 подразделяется на кузов с трехсторонней возможностью опрокидывания кузова, а также с односторонним опрокидыванием. Возможность выгрузки грузов на несколько сторон также сказывается на грузоподъемности.

Силовая установка, несущая часть

Самосвал ГАЗ-3309 состоит несущей рамы, на которую спереди монтируется силовая установка и передний управляемый мост. Ближе к средней части располагается коробка передач и насос гидравлической системы. Над ними располагается трехместная кабина закрытого типа.

В задней части рамы расположен ведущий мост с карданным приводом. На раму установлена грузовой кузов, соединенный с телескопическим гидравлическим цилиндром.

Двигатель Д-245, который зарекомендовал себя, как надежна силовая установка, установлена на раму посредством резиновых подушек. Сам силовой агрегат является 4-цилиндровым, с рядным положением цилиндров. Система питания дополнительно оснащена турбонаддувом и интеркулером.

Силовая установка Ярославского производства имеет обозначение ЯМЗ-534, тоже является 4-цилиндровой и оснащена турбонаддувом, но по объемному показателю она чуть меньше Д-245, а вот по мощности – сильнее.

Рама на 3309 используется классическая лонжеронная. Состоит она из двух продольных лонжеронов, соединенных между собой поперечинами. Именно она является несущей частью и к ней крепятся все остальные части авто.

Кузов представляет собой платформу с откидными бортами. Существует возможность наращивания высоты бортов, для увеличения объема кузова.

К раме кузов крепится шарнирными замками штифтового типа. Ими же и обеспечивается возможность опрокидывания кузова в трех направлениях. Для этого достаточно вытянуть штифты замка с нужной стороны.

Схема самосвала ГАЗ-3309

Трансмиссия, гидравлика, подвеска

Гидравлическая система авто, позволяющая опрокидывать кузов, состоит из коробки отбора мощности, с интегрированным в нее гидравлическим насосом. Установлена она на коробке передач. Посредством гидравлических магистралей она связана с телескопическим цилиндром, нижний край которого закреплен на раме, а верхний – подсоединен к платформе кузова. Забор масла у этой системы производится из отдельного масляного бака.

На данном авто используется механическая коробка передач с 5 скоростями. Крутящий момент от нее к ведущему валу осуществляется карданным валом. Главная передача ведущего моста – коническая, гипоидная с шестеренчатым коническим дифференциалом.

Подвеска у авто – зависимая, рессорная. Спереди дополнительно используются амортизаторы.

Кабина – герметическая, 3-местная, оборудована системой вентиляции и отопления. Управление системой подъема кузова осуществляется из кабины, выведенным в нее рычагом.

Технические характеристики

Технические характеристики самосвала дизель ГАЗ-3309:

Характеристики Ед. измерения Показатели
Силовая установка:
— Д-245 тип 4-цилиндр., дизель
— ЯМЗ-534 тип 4-цилиндр., дизель
Мощность:
— Д-245 л.с. 125
— ЯМЗ-534 л.с. 134
Коробка передач тип мех., 5-ступенчатая
Колесная формула тип 4х2
Габариты:
— длина мм 6471
— длина грузовой платформы мм 3516
— ширина мм 2456
— высота по кабине мм 2320
Высота по кузову (без надстроек) мм 1828
База колесная мм 3770
Клиренс мм 265
Угол подъема кузова назад град. 50
Угол подъема кузова вбок (при трехсторонней выгрузке) град. 45
Грузоподъемность кг 1500-3500
Скорость максимальная км/ч 95
Среднее потребление топлива л/100 км 14,5-19,3
Вес 3850 кг

КД2995В без крепежа, Мощный выпрямительный диод

КД2995В без крепежа, Мощный выпрямительный диод

Технические параметры

Максимальное постоянное обратное напряжение, В   100
Максимальное импульсное обратное напряжение, В   100
Максимальный прямой(выпрямленный за полупериод) ток,А   25
Максимально допустимый прямой импульсный ток,А   75
Максимальное прямое напряжение,В   1.1
при Iпр.,А   30
Рабочая температура,С   -60…125
Корпус   kd11

Диоды выпрямительные
Пр-во Uобр. max, В Iпр. max, А Iпр. имп. max, А Корпус Наличие
Производители
DC Components  Fairchild  Ixys  No trademark  ON Semiconductor  ST Microelectronics  Vishay  Vishay/IR  Китай Россия  СЗТП

Наименование   Пр-во   Uобр. max, В   Iпр. max, А   Iпр. имп. max, А   Корпус   Наличие   Цена  
КД258Д, Диод 1.5А 1000В [КД-29А] (BYV96E) СЗТП   1000   1.5   7.5   kd 29 a   Со склада   45 
КД280А, Диод выпрямительный 3А 50В [КД-7Е / DO-201AD] (1N5400)
КД280Б, Диод выпрямительный 3А 100В [КД-7Е / DO-201AD] (1N5401)
КД280В, Диод выпрямительный 3А 200В [КД-7Е / DO-201AD] (1N5402)
КД280Г, Диод выпрямительный 3А 400В [КД-7Е / DO-201AD] (1N5404)
КД280Д, Диод выпрямительный 3А 600В [КД-7Е / DO-201AD] (1N5406)
КД280Е, Диод выпрямительный 3А 800В [КД-7Е / DO-201AD] (1N5407)
КД2994А, Мощный выпрямительный диод
КД2995В без крепежа, Мощный выпрямительный диод Россия   100   25   75   kd11   Со склада   73 
КД2997А, Мощный выпрямительный диод
КД2997Б, Мощный выпрямительный диод, 30А, 100В
КД2999А без крепежа, Мощный выпрямительный диод
VS-40EPS08PBF, Диод 40А 800В [TO-247AC] Vishay   Со склада   100 
6A05 (P600A), Диод выпрямительный 6А 50В [R-6] Китай   50   6   400   r-6   Со склада   10 
6A10 (P600M), Диод выпрямительный 6А 1000В [R-6]
6A2 (P600D), Диод выпрямительный 6А 200В [R-6]
6A6 (P600J), Диод выпрямительный 6А 600В [R-6]
VS-80EBU04, Диод 400В 80А 50нс [PowerTab] Vishay/IR   400   80   800   powirtab   Со склада   260 
BYG20G-E3/TR, Диод лавинный сверхбыстрый, 1.5А, 400В [SMA / DO-214AC]
EM518, Выпрямительный диод 1А 2000В [DO-41]
Китай   1300   1   30   do41   Со склада   7 −+
 

Наименование   Пр-во   Uобр. max, В   Iпр. max, А   Iпр. имп. max, А   Корпус   Наличие   Цена  
GS1M (SMA4007), Диод 1А 1000В [SMA / DO-214AC] Китай   1000   1   30   do214ac   Со склада   3.70 
M1, Диод 1А 50В [SMA-F]
M3, Диод 1А 200В [SMA-F]
M5, Диод 1А 600В [SMA-F]
RL201, Диод 2А 50В [DO-15] Китай   50   2   70   do15   Со склада   2.50 
RL202, Диод 2А 100В [DO-15]
RL203, Диод 2А 200В [DO-15]
RL204, Диод 2А 400В [DO-15]
RL205, Диод 2А 600В [DO-15]
RL206, Диод 2А 800В [DO-15]
RL207, Диод 2А 1000В [DO-15]
S2M, Диод 2А 1000В [SMB / DO-214AA]
SM4001, Диод 1A 50В [MELF / DO-213AB] Китай   50   1   30   sm-1   Со склада   4 
SM4002, Диод 1А 100В [MELF / DO-213AB]
SM4003, Диод 1А 200В [MELF / DO-213AB]
SM4004, Диод 1А 400В [MELF / DO-213AB]
SM4005, Диод 1А 600В [MELF / DO-213AB]
SM4006, Диод 1А 800В [MELF / DO-213AB]
SM4007, Диод 1А 1000В [MELF / DO-213AB]
Д220, Диод выпрямительный
 
Д220Б, Диод выпрямительный Россия   100   0.05   0.5   d104   Со склада   4.90 
Д223, Выпрямительный диод малой мощности
Д223А, Диод кремниевый сплавной, импульсный
Д223Б, Выпрямительный диод малой мощности
Д226Д, Диод выпрямительный
Д237А «5», Диод выпрямительный
Д237Б, Диод выпрямительный
Д242, Выпрямительный диод СЗТП   100   10   кдю-11-4   Со склада   86 
Д242А, Выпрямительный диод большой мощности
Д242Б, Диод выпрямительный средней мощности
Д243, Диод выпрямительный
Д243А, Диод выпрямительный
Д245, Диод 300А 10А
Д245А, Диод выпрямительный
Д245Б, Выпрямительный диод средней мощности СЗТП   300   5   kdu114   Со склада   64 
Д247, Выпрямительный диод средней мощности
Д310, Диод германиевый диффузионный, универсальный Россия   20   0.5   1.5   d104   Со склада   12 
Д9Б, Диод выпрямительный малой мощности, германиевый
Д9В, Диод выпрямительный малой мощности, германиевый
Д9К, Диод выпрямительный малой мощности, германиевый
Страницы Ctrl ← предыдущая Ctrl → следующая


Наименование   Пр-во   Uобр. max, В   Iпр. max, А   Iпр. имп. max, А   Корпус   Наличие   Цена  
10A10, Диод 10А 1000В No trademark   По запросу   19 
КД128А, Выпрямительный диод малой мощности Россия   50   0.16   kt-13   Со склада   1.50 
1A3, Диод 1А 200В Китай   200   1   25   r1   По запросу   6 
1N4447, Диод Fairchild   Со склада   17
1N5062, Диод выпрямительный 1А 800В DO15 No trademark   3 дня   7.50 
КД209Г, Диод выпрямительный СЗТП   Со склада   7 
VS-20ETS12PBF, TO220-2 Vishay   Со склада   30 
КД212Б без крепежа Россия   1-2 недели   150 
31DF4 DO-204AR, Выпрямительный диод Vishay/IR   Со склада   37
VS-60APU04PBF, Диод, Ultrafast Soft Recovery, 60А, 400В [TO-247AC]
VS-70HF120, Диод 70А 1200В 50Гц DO-5 Vishay/IR   1200   70   110   do203ab   По запросу   360
BAV199LT1G, 2 диода, 70В, 200мА, 6нс, последовательные, SOT-23 (маркировка- JY*) ON Semiconductor   3 дня   9.80 
BYG22D-E3/TR, Диод 2А 200В [DO-214AC]
BYW29-200 TO-220AC, Диод ST Microelectronics   По запросу   33 
DSEP15-06A, Диод Ixys   По запросу   240 
PS-152, Диод 1.5А 200В DO15 Китай   200   1.5   50   do15   Со склада   18 
SF26 No trademark   3 дня   32 
STPS745G-TR ST Microelectronics   Со склада   30
Д311А, Диод выпрямительный
1N5398 DC Components   3 дня   4.60 


1N5398 (1.5A 800V) DO-1 No trademark   1-2 недели
 

p32 является негативным регулятором тетрамеризации и трансактивации p53

Abstract

p53 является специфичным к последовательности фактором транскрипции, и правильная регуляция транскрипционной активности p53 имеет решающее значение для управления различными механизмами подавления опухолей. p32 представляет собой многофункциональный белок, который взаимодействует с большим количеством вирусных белков и факторов транскрипции. Здесь мы исследуем влияние р32 на трансактивацию р53 и идентифицируем новый механизм, с помощью которого р32 изменяет функциональные характеристики р53.В частности, р32 ослабляет р53-зависимую транскрипцию за счет нарушения связывания р53 с его ответными элементами на генах-мишенях. При экспрессии p32 уровни p53, связанные с генами-мишенями, снижаются, а гены-мишени p53 инактивируются, что убедительно указывает на то, что p32 ограничивает занятость p53 и функцию генов-мишеней. Основным механизмом, способствующим наблюдаемому действию р32, является способность р32 взаимодействовать с доменом тетрамеризации р53 и блокировать тетрамеризацию р53, что, в свою очередь, усиливает ядерный экспорт и деградацию р53, что приводит к дефектной трансактивации р53.В совокупности эти данные свидетельствуют о том, что р32 является негативным регулятором функции р53, и предполагают терапевтический потенциал нацеливания на р32 для лечения рака.

Ключевые слова: сигнал ядерного экспорта , р32, р53, тетрамеризация, транскрипция для расщепления 5′-сайта сплайсинга и образования лариата во время сплайсинга пре-мРНК в клетках HeLa (Krainer et al., 1990). Первоначальный анализ обнаружил p32 в митохондриальном матриксе, но в более поздних исследованиях также сообщалось, что p32 присутствует в ядре, предполагая, что p32 может перемещаться между митохондриями и ядром в зависимости от его функции (Matthews and Russell, 1998). p32 существует в равновесии между мономерами и тримерами, которые сохраняют специфическую аффинность связывания с другими белками (Jha et al. , 2002; Jiang et al. , 1999). Расшифровка кристаллической структуры p32 показала, что p32 может образовывать тример в форме пончика с отрицательно заряженными остатками, асимметрично распределенными на одной стороне и выстилающими канал комплекса (Jiang et al., 1999). Было показано, что p32 обладает способностью взаимодействовать с несколькими вирусными белками, включая коровый белок V аденовируса, ORF P вируса простого герпеса, EBNA-1 вируса Эпштейна-Барр и ВИЧ-1 Tat and Rev (Bruni and Roizman, 1996; Desai et al. , 1991; Fridell et al. , 1995; Luo et al. , 1994; Matthews and Russell, 1998; Tange et al. , 1996; Wang et al. , 1997 и др. , 1995; Ю и др. , 1995). Эти результаты предполагают его возможную важность в регуляции репликации и генерации вирусных частиц.Сообщалось также, что p32 связывается с С-концевой областью общего фактора транскрипции IIB (TFIIB), что привело к предположению, что p32 может быть непосредственно вовлечен в транскрипцию, действуя в качестве связующего фактора между TFIIB и активаторами транскрипции (Yu et al. , 1995; Ю и др. , 1995). В дополнение к списку разнообразных партнеров по связыванию также сообщалось о взаимодействии p32 с рецептором ламина B, высокомолекулярным кининогеном и фактором XII, компонентом комплемента плазмы C1q, витронектином и гиалуроновой кислотой (Deb and Datta, 1996; Ghebrehiwet et al. ., 1994; Гервальд и др. , 1996; Лим и др. , 1996; Симос и Георгатос, 1994). С функциональной точки зрения р32 участвует в поддержании митохондриального окислительного фосфорилирования (Muta et al. , 1997), а также в обеспечении ARF-индуцированного апоптоза (Itahana and Zhang, 2008). Сильное подтверждение онкогенной функции p32 также обеспечивается исследованиями, демонстрирующими, что раковые клетки обычно экспрессируют более высокие уровни p32 по сравнению со своими нормальными аналогами (Chen et al., 2009; Фогал и др. , 2008; Рубинштейн и др. , 2004).

Опухолевой супрессор p53 играет важную роль в клеточном ответе на различные стрессы, такие как повреждение ДНК, гипоксия и аберрантные сигналы онкогенов. Хотя некоторые эффекты р53 могут включать нетранскрипционные механизмы, многие роли, которые играет р53, опосредованы его функцией транскрипционного фактора, который индуцирует специфические программы транскрипции генов (Jiang et al. , 2010; Murray-Zmijewski et al., 2008; Speidel и др. , 2006). р53 можно разделить на четыре основных домена в зависимости от их структуры и функции: N-концевой домен трансактивации (1–80 остатков), центральный ДНК-связывающий домен (100–300 остатков), домен тетрамеризации (323–355 остатков). и С-концевой регуляторный домен (364–393 а.о.) (Joerger and Fersht, 2007; Wang et al. , 1994). В не подвергнутых стрессу клетках p53 существует в виде мономера, который конститутивно убиквитинирован и быстро деградирует через убиквитиновые протеасомные пути в цитоплазме (Brooks and Gu, 2006).При повреждении ДНК p53 стабилизируется и активируется с образованием тетрамерного комплекса, в котором блокируется сигнал ядерного экспорта (NES), обеспечивая сохранение активного тетрамера в ядре, где он действует с помощью С-концевого регуляторного домена. на гены-мишени (Prives and Hall, 1999; Sullivan et al. , 2018). Таким образом, тетрамеризация является одним из основных механизмов, ответственных за стабилизацию р53 и его трансактивную функцию в ответ на повреждение ДНК. Раковые клетки разработали несколько стратегий, позволяющих избежать p53-опосредованного ответа на стресс, одна из которых заключается в ингибировании образования тетрамера.В связи с этим сообщалось, что несколько мутаций в домене тетрамеризации р53 нарушают образование тетрамера р53 и тем самым ингибируют связывание ДНК и активность трансактивации (Chene, 2001). Предыдущие отчеты также показали, что некоторые белки, взаимодействующие с р53, снижают потенциал связывания ДНК р53, блокируя образование тетрамеров, что дает представление о том, как их присутствие может переводить гены-мишени р53 из активного состояния в латентное неактивное состояние. Ван Дик и др., 2009; Foo и др. , 2007; Лин и др. , 2004; Луи и др. , 2015).

В рамках попытки понять вклад N-концевых хвостов гистона h5 в реакцию транскрипции мы ранее очистили и охарактеризовали множество регуляторных факторов, которые могут взаимодействовать с хвостовыми доменами h5. Наши функциональные анализы продемонстрировали, что факторы, ассоциированные с хвостом h5, оказывают специфическое влияние на p53-зависимую реакцию транскрипции (Choi et al. , 2007).В настоящем исследовании мы объединили серию биохимических и клеточных методов для дальнейшего изучения роли, которую играют эти связанные с хвостом факторы в регуляции функции p53. Наши данные показывают, что р32, один из связанных с хвостом факторов, участвует в установлении и поддержании репрессивного состояния р53-зависимой транскрипции посредством своего физического взаимодействия с р53. Используя мутированные формы p32, мы также показываем, что p32 взаимодействует с доменом тетрамеризации p53 и предотвращает связывание p53 с его ответными элементами.Дополнительные анализы с клетками, экспрессирующими эктопические формы р32 дикого типа по сравнению с формами р53 с дефицитом связывания, подтверждают физиологическую значимость наблюдаемого действия р32 на инактивацию р53 посредством вмешательства в тетрамеризацию р53. В целом, эти исследования предоставляют беспрецедентную документацию о функциональном свойстве р32, непосредственно направленном на транскрипционную активность р53, а также об основном механизме действия как in vitro , так и in vivo .

2. Материалы и методы

2.1. Клеточные линии, конструкции и антитела

h2299 и клетки U2OS культивировали в среде Игла, модифицированной Дульбекко, с добавлением 10% эмбриональной телячьей сыворотки в атмосфере 5% СО 2 при 37 °C. Для экспрессии р32 и р53 у млекопитающих соответствующие кДНК амплифицировали с помощью ПЦР и лигировали в правильные рамки считывания pIRESneo (Clontech Laboratories, Inc., Маунтин-Вью, Калифорния, США), содержащие 5′-последовательности, кодирующие FLAG или гемагглютинин (HA). Для бактериальной экспрессии p32, p53, SRp30c и p66α их кДНК амплифицировали с помощью ПЦР и встраивали в векторы pET15b и/или pGEX-4T1.Для создания мутантных векторов экспрессии р32 кДНК р32 дикого типа мутировали с использованием набора для направленного мутагенеза Q5® (New England Biolabs, Ипсвич, Массачусетс, США) после конструирования. Все конструкции были подтверждены секвенированием ДНК. Более подробную информацию о конструкциях плазмид можно получить по запросу. В этом исследовании использовались следующие антитела: антитела против β-актина и против FLAG от Sigma-Aldrich, Сент-Луис, Миссури, США; анти-His-антитело от LifeTein, Сомерсет, Нью-Джерси, США; антиламиновое антитело от Active Motif, Карлсбад, Калифорния, США; антитело против НА от Proteintech, Розмонт, Иллинойс, США; и антитела против тубулина, анти-p32 и анти-p53 (DO-1) от Santa Cruz Biotechnology, Даллас, Техас, США.

2.2. Получение рекомбинантных белков

Рекомбинантные гистоны экспрессировали в клетках Escherichia coli Rosetta 2 (DE3) pLysS (Novagen, Burlington, MA, USA) и очищали, как описано ранее (Dyer et al. , 2004; Mueller et al. , 2004). Меченные FLAG p53, SRp30c и p66α были экспрессированы в клетках E. coli Rosetta 2 (DE3) pLysS и очищены с помощью агарозы против FLAG M2 (Sigma-Aldrich). Его-меченый p32 и NAP-1 экспрессировались в E.coli Rosetta 2 (DE3) pLysS и очищали с помощью Ni-NTA His·Bind Resin (Millipore, Burlington, MA, USA) в соответствии со стандартными протоколами. FLAG-меченый p300, ATP-утилизирующий фактор сборки хроматина 1 (Acf1) и ISWI были экспрессированы в клетках насекомых Sf21 с использованием бакуловирусной системы экспрессии и очищены с помощью анти-FLAG M2 агарозы (An and Roeder, 2004). Белки, слитые с глутатион S -трансферазой (GST), экспрессировали и очищали на гранулах глутатион-сефарозы 4B (GE Healthcare, Чикаго, Иллинойс, США), как описано в наших предыдущих исследованиях (Kim et al., 2008 г.).

2.3.

Анализ транскрипции in vitro

Матрицы хроматина были собраны, как описано (Kim et al. , 2012), с использованием рекомбинантных гистонов и АТФ-утилизирующего фактора сборки хроматина ACF и белка сборки нуклеосом 1. Были проведены анализы транскрипции in vitro с использованием 40 нг ДНК pG5ML601-280G или шаблонов хроматина для каждой реакции. Рекомбинантные p32, SRp30c и p66α добавляли вместе с p53 (20 нг) или p300 (20 нг) в реакции транскрипции.Транскрипты с радиоактивной меткой разделяли на 5% мочевине-PAGE и обнаруживали авторадиографией (Choi et al. , 2007).

2.4.

Анализ связывания ДНК in vitro

Конъюгированные с биотином фрагменты ДНК длиной 230 п.н., содержащие отвечающий элемент p53 (p53RE), были синтезированы из плазмиды p53ML с помощью ПЦР-амплификации с использованием 5′-биотинилированного праймера (5′-TCTTTAAACTCGAGTGCATG-3′) и 3′-праймер (5′-AGGGGGTATGGAAGGAGA-3′) и иммобилизованный на стрептавидине Dynabeads M-280 (Invitrogen, Карлсбад, Калифорния, США).Иммобилизованный на шариках p53RE сначала инкубировали с FLAG-p53 (100 нг) и p32 (80 нг) в буфере для вытягивания (10 мМ Трис/HCl, pH 7,5, 50 мМ NaCl, 1 мМ ЭДТА, 1 мМ DTT и 10 % глицерина) при осторожном встряхивании при 30 °C в течение 60 минут в присутствии 20 мкг полид(I-C) (Roche, Базель, Швейцария). Затем шарики отделяли от супернатанта с помощью концентратора магнитных частиц (Dynal MPC-S). После трехкратной промывки буфером для вытягивания равные объемы шариков подвергали анализу SDS/PAGE и вестерн-блоттингу.

2.5. РНК-интерференция

ДНК-олигонуклеотиды, кодирующие кшРНК, специфичную для кодирующей области p32 (GGATGAGGTTGGACAAGAAGA), отжигали и лигировали в лентивирусный вектор экспрессии pLKO.1 (Addgene, Кембридж, Массачусетс, США). Лентивирусные частицы были получены в клетках 293T путем трансфекции плазмид, кодирующих VSV-G, NL-BH и кшРНК. Для истощения p32 в клетках U2OS эти вирусы инфицировали и отбирали в течение 2 недель в присутствии 2 мкг·мл -1 пуромицина.Изменения экспрессии p32 измеряли с помощью вестерн-блоттинга и количественной ПЦР в реальном времени (RT-qPCR).

2.6. RT-qPCR

Тотальную РНК выделяли из клеток h2299/U2OS с использованием набора RNeasy Mini (Qiagen, Hilden, Германия) и преобразовывали в кДНК первой цепи с помощью набора для синтеза кДНК iScript (Bio-Rad, Hercules, CA, США). . ОТ-ПЦР в реальном времени проводили с помощью набора QuantiTect SYBR Green RT-PCR (Qiagen) в соответствии с протоколом производителя. Праймеры, используемые для RT-qPCR, перечислены в таблице.Анализы были нормализованы к уровням мРНК β-актина . Все реакции проводили в трех экземплярах, результаты усредняли.

Таблица 1

Список праймеров, используемых в RT-qPCR.

Название гена Прямой праймер (5’–3′) Обратный праймер (5’–3′)
стр.21 ATGGAACTTCGACTTTGTCAC AGGCACAAGGGTACAAGACAGT
НОКСА CCAGTTGGAGGCTGAGGTTC CGTTTCCAAGGGCACCCATG
БАКС CGTCCACCAAGAAGCTGAGCG AGCACTCCCGCCACAAAGATG
Репримо CTGGCCCTGGGACAAAGAC TCAAAACGGTGTCACGGATGT
БТГ2 TGAGGTGTCCTACCGCATTG GCACTTGGTTTCTTGCAGGTG
ПУМА ACGACCTCAACGCACAGTACGA GTAAGGGCAGGAGTCCCATGATGA
АПАП1 GCTGCCATTTCACCAACAGT CTCTCATTTGCTGATGTCGC
ГАДД45 AGCGGAAGAGATCCCTGTGA CGGGAGGCAGGCAGATG
ГАПДХ GGCCTCCAAGGAGTAAGACC AGGGGAGATTCAGTGTGGTG
β-актин GTGGGGCGCCCCAGGCACCA CTCCTTAATGTCACGCACGATTTC

2.7. Анализы ChIP

ChIP с клетками h2299 проводили с использованием набора для анализа ChIP (Millipore), как недавно описано (Kim et al. , 2008). Для иммунопреципитации использовали антитело p53 (DO-1). После обращения перекрестных связей белок-ДНК иммунопреципитированную ДНК очищали и анализировали с помощью количественной ПЦР с использованием праймеров, которые амплифицируют области p53RE генов p21, Noxa, BAX, Reprimo, BTG2, PUMA, APAF1 и GADD45 . Праймеры, используемые для количественной ПЦР, перечислены в таблице.Специфичность амплификации определяли анализом кривой плавления, и все образцы анализировали в трех повторностях.

Таблица 2

Список праймеров, используемых в ChIP-qPCR.

Название гена Прямой праймер (5’–3′) Обратный праймер (5’–3′)
стр.21 TGGACTGGGCACTCTTGTCC CAGAGTAACAGGCTAAGGTT
НОКСА GTCCAGCGTTTGCAGATG AACGAGGTGGGAGGAGAA
БАКС AGATCATGAAGACAGGGGCCCTTT TGGAGTGAGGGTGCAGAATCAGAA
Репримо GGGGAGGGGCGATAAATACC GTAACTCCTCAGGCAGGCAA
БТГ2 AGACGAGGCAAAGCGGTAAA TCCAACCATTCACGGTCAGA
ПУМА GCGAGACTGTGGCCTTGTGT CGTTCCAGGGTCCACAAAAGT
АПАП1 CACTGAAACATCCTCCATTA AGGAGAATTAATGAGTTTCCAA
ГАДД45 GGATCTGTGGTAGGTGAGGGTCAGG GGAATTAGTCACGGGAGGCAGTGCAG

2.8. Белково-белковые взаимодействия

Для анализа коиммунопреципитации p53 и FLAG-меченные белки дикого типа/мутантные p32 коэкспрессировали в клетках h2299, а лизаты цельных клеток готовили из клеток в буфере для лизиса клеток (50 мМ Трис/HCl, pH 7,4, 150 мМ NaCl, 1 мМ ЭДТА, 1% Triton X-100 и смесь ингибиторов протеазы). Лизаты клеток смешивали с антителами анти-FLAG и анти-p53, конъюгированными с гранулами, в течение ночи при осторожном вращении при 4 °C. После удаления супернатанта осадки образцов анализировали с помощью вестерн-блоттинга с антителами анти-FLAG и анти-p53.Для исследований взаимодействия in vitro, His-меченый p32 и FLAG-меченый p53 инкубировали в течение ночи с GST-слитыми белками p53 и GST-слитыми p32, иммобилизованными на гранулах глутатион-сефарозы (GE Healthcare) при 4 °C в буфере для связывания (20 м Трис/HCl, pH 7,3, 0,2 м KCl, 0,2 мМ ЭДТА, 20 % глицерин, 0,01 % нонидет P-40 и смесь ингибиторов протеаз). После трехкратного промывания гранул буфером для связывания связанные белки обнаруживали с помощью вестерн-блоттинга.

2.9. анализы тетрамеризации р53

Для анализов тетрамеризации р53 in vitro меченные FLAG белки р53 инкубировали с р32 в молярном соотношении 1 : 1, 1 : 2 или 1 : 4 в течение ночи при 4 °C в буфере для перекрестного связывания (10 мМ Трис/HCl, pH 7.5, 50 мМ NaCl, 0,1 мМ ЭДТА, 1 мМ ДТТ, 5% глицерин и смесь ингибиторов протеазы). После обработки глутаральдегидом (0,01%) в течение 10 минут при 22 °C реакции останавливали добавлением буфера для образцов SDS/PAGE, разделяли на 10% SDS/PAGE и подвергали вестерн-блоттингу для обнаружения мономерных, димерных и тетрамерные формы p53. Для анализов тетрамеризации p53 in vivo клетки h2299 трансфицировали векторами млекопитающих, экспрессирующими p32 и p53 с меткой FLAG дикого типа/мутанта. Через 24 часа после трансфекции клеточные лизаты готовили в буфере для сшивания и обрабатывали глутаровым альдегидом в конечной концентрации 0.02%. Сшитые лизаты подвергали вестерн-блоттингу с антителом против р53 для обнаружения мономеров/димеров/тетрамеров р53. Чтобы увидеть влияние p32 на тетрамеризацию эндогенного p53, клетки U2OS трансфицировали векторами млекопитающих, экспрессирующими p32 дикого типа или мутантный, в течение 24 ч, а клеточные лизаты анализировали с помощью вестерн-блоттинга с антителом против p53.

2.10. Субклеточное фракционирование и иммунофлуоресцентная микроскопия Клетки

h2299 трансфицировали векторами экспрессии p32/p53, а клетки U2OS обрабатывали этопозидом (50 мкМ).Клетки собирали и ресуспендировали в буфере для лизиса клеток (20 мМ HEPES, pH 7,5, 10 мМ KCl, 1 мМ DTT, 1 мМ PMSF, 10% глицерин и смесь ингибиторов протеаз). Смесь кратко встряхивали и инкубировали на льду в течение 15 мин. Ядра осаждали центрифугированием при 1000 g в течение 5 мин при 4 °C, тогда как надосадочную жидкость (цитоплазматические экстракты) извлекали центрифугированием при 10 000 g в течение 20 мин. Ядра дважды промывали буфером для лизиса клеток, ресуспендировали в буфере для экстракции ядер (20 мМ HEPES, pH 7.5, 0,4 м NaCl, 1 мМ DTT, 1 мМ PMSF, 10% глицерин и смесь ингибиторов протеаз), и инкубировали на льду в течение 30 мин. Затем смесь центрифугировали при 15 000 g в течение 10 минут и собирали супернатант в виде ядерного экстракта. Цитоплазматические и ядерные фракции подвергали 12% SDS/PAGE с последующим вестерн-блоттингом с антителами против FLAG (p32), против HA (p53), против актина, против ламина и против тубулина. Для иммунофлуоресценции клетки фиксировали 4% (об./об.) параформальдегидом в течение 15 мин, пермеабилизировали 0.3% Triton X-100 в течение 15 мин и иммуноокрашивание антителами против FLAG (p32) и против HA (p53). Флуоресцентную микроскопию проводили на микроскопе Zeiss, а изображения обрабатывали с помощью программного обеспечения Adobe Photoshop. Уровни ядерного р53 количественно определяли путем оценки площади ядра для иммунофлуоресценции с помощью программного обеспечения imagej 1,48v (Национальные институты здравоохранения, Бетесда, Мэриленд, США) по следующей формуле:

Скорректированная флуоресценция = общая выбранная площадь флуоресценции * средняя фоновая флуоресценция.

2.11. Анализ репортерного гена

клеток h2299 высевали в 12-луночные планшеты при 50% слиянии и трансфицировали репортером p53RE-luc (200 нг), содержащим p53RE, и векторами экспрессии для p53 (50 нг) и p32, SRp30c или p66α (100 и 200 нг) в течение 24 ч. Клетки собирали в буфере Reporter Lysis Buffer (Promega, Madison, WI, USA) и анализировали на активность люциферазы с использованием Odyssey System Premium (LI-COR Bioscience, Lincoln, NE, USA).

2.12. Анализ жизнеспособности клеток

Жизнеспособность клеток определяли количественно с использованием реагента для пролиферации клеток WST-1 (Roche Diagnostics) в соответствии с протоколом производителя.Вкратце, клетки U2OS (1 × 10 4 клеток на лунку -1 ) обрабатывали этопозидом (50 мкм) в течение 0, 12, 24, 48 и 72 ч в 96-луночных культуральных планшетах. После обработки в каждую лунку добавляли 10 мкл реагента для пролиферации клеток WST-1 с последующей инкубацией в течение 2 часов при 37 °C. Пролиферацию и жизнеспособность клеток количественно определяли путем измерения поглощения при 460 нм с использованием устройства для считывания микропланшетов.

3. Результаты

3.1. p32 репрессирует p53-зависимую транскрипцию

В нашем предыдущем исследовании было выявлено несколько факторов, которые могут специфически связываться с N-концевыми хвостовыми доменами гистона h5 дикого типа или с лизин-мутированными (Choi et al., 2007) (рис. S1). В экспериментах по транскрипции с использованием этих ассоциированных факторов мы заметили, что факторы, ассоциированные с хвостом h5 дикого типа, но не мутантные факторы, ассоциированные с хвостом, могут модулировать р53-зависимую транскрипцию хроматина при добавлении вместе с р300 в реакции (Choi et al. , 2007). Чтобы проверить, могут ли эти факторы, связанные с хвостом, более точно влиять на транскрипцию, мы сначала провели эксперименты с порядком добавления, как показано на рис. S2A. В нашей системе анализа с использованием плазмиды, содержащей p53RE, транскрипция хроматина зависит от активатора p53, кофактора p300 и ацетил-КоА, в то время как ДНК-матрицы без гистонов могут транскрибироваться исключительно в присутствии p53 (рис.А). В соответствии с нашими опубликованными данными (Choi et al. , 2007), одновременное добавление связанных с хвостом факторов h5 дикого типа и p300 усиливало p53-зависимую транскрипцию с хроматиновых матриц, но не с матриц ДНК (Fig. A). Замена связанных с хвостом факторов дикого типа h5 мутантными связанными с хвостом факторами в этой реакции не вызывала изменений в реакциях транскрипции. Когда эффекты связанных с хвостом факторов дикого типа исследовали путем добавления их вместе с p53, активация транскрипции с хроматиновых матриц все еще наблюдалась.Интересно, однако, что параллельные анализы транскрипции, в которых мутантные факторы, ассоциированные с хвостом, добавляли вместе с p53, приводили к отчетливой репрессии транскрипции как ДНК, так и хроматина (Fig. A).

Репрессивные эффекты р32 на р53-зависимую транскрипцию. (A) Реконструированные массивы нуклеосом и свободная ДНК были транскрибированы в присутствии факторов p53 (10 нг), p300 (20 нг), ацетил-КоА (10 мМ) и/или факторов, связанных с хвостом h5 (40 нг), как указано в (А). Факторы дикого типа или лизиновые мутации h5, связанные с хвостом, добавляли вместе с p53 или p300, как указано.Транскрипты с радиоактивной меткой разделяли на 5% PAGE, содержащем 7 моль мочевины, и обнаруживали с помощью авторадиографии. Интенсивность полос на авторадиограмме измеряли денситометрией с использованием программного обеспечения imagej 1.48v, и показанные результаты являются репрезентативными для трех независимых экспериментов. (B) Анализы транскрипции проводили в условиях, описанных в подписи к рис. B, но вместе с p53 добавляли рекомбинантные p32, SRp30c и p66α. (C) клетки h2299 трансфицировали экспрессионными плазмидами, кодирующими p53 и p32, в течение 24 часов.Тотальную РНК получали из клеток и проводили RT-qPCR с использованием праймеров, специфичных для указанных генов-мишеней p53. Последовательности праймеров перечислены в таблице. Уровни мРНК из каждой реакции нормализовали относительно внутреннего контроля β-актина . Показанные результаты представляют собой средние значения из трех независимых экспериментов, а значения, полученные из ложно-трансфицированных клеток, установлены на 1. Столбики погрешностей представляют стандартное отклонение.

Поскольку p32, SRp30c и p66α были специфически связаны с мутантными хвостами h5 (рис.S1), мы хотели определить, какие из этих факторов непосредственно вовлечены в наблюдаемое вытеснение. Для этой цели p32, SRp30c и p66α были экспрессированы в бактериях и аффинно очищены, как описано в разделе 2.22.2 и показано на рис. S2B. Стоит отметить, что p32 синтезируется как пробелок из 282 аминокислот, находящихся в цитоплазме, прежде чем подвергается расщеплению аминокислот 1–73 с образованием зрелой формы белка (Murakami et al. , 1993). Когда анализы транскрипции проводились с каждым из этих рекомбинантных факторов, наблюдалась небольшая репрессия транскрипции или ее отсутствие при добавлении SRp30c или p66α вместе с p53 (фиг.Б). Однако добавление зрелого белка p32 вместе с p53 приводило к значительно более низкому уровню транскрипции, что убедительно подтверждает, что p32 в основном отвечает за репрессивные эффекты мутантных факторов, связанных с хвостом (Fig. B). Как и ожидалось, р32 не оказывал заметного влияния на трансактивацию р53, когда его добавляли в реакции транскрипции вместе с р300 (не показано). Чтобы дополнительно подтвердить наши выводы, мы также провели количественный анализ RT-PCR (RT-qPCR) восьми репрезентативных генов-мишеней p53 с использованием линии клеток рака легких p53-null h2299.Как показано на рис. C, экспрессия эктопического p53 активировала транскрипцию генов-мишеней p53, но коэкспрессия p32 значительно подавляла трансактивацию генов-мишеней p53 в клетках. Во всех случаях уровни мРНК гена-мишени не-p53 GAPDH остаются неизменными. При проверке возможных эффектов SRp30c и p66α им не удалось уменьшить степень экспрессии гена-мишени p53 в клетках, трансфицированных p53 (рис. S3). Кроме того, эти результаты полностью согласуются с данными, указывающими на то, что коэкспрессия р53 с р32 приводила к значительно более низкой активности р53-чувствительного репортерного гена люциферазы по сравнению с его трансфекцией SRp30c и р66α (рис.С4). Взятые вместе с нашими данными in vitro , эти эксперименты недвусмысленно демонстрируют избирательное ингибирующее действие p32 против p53-зависимой активации транскрипции.

3.2. p32 связывается с доменом тетрамеризации p53

В целом, данные о транскрипции, представленные выше, устанавливают роль p32 как негативного регулятора p53-опосредованной трансактивации. Однако неясно, отражают ли репрессивные эффекты р32 его физическое взаимодействие с р53. Чтобы проверить эту возможность, мы трансфицировали клетки h2299 плазмидами, экспрессирующими p53 и FLAG-меченый p32, и иммунопреципитировали цельноклеточные лизаты антителами против FLAG.В дополнение к p32 мы могли подтвердить присутствие p53 в наших иммунопреципитатах с помощью вестерн-блоттинга (рис. A). Эти данные о связывании были дополнительно подтверждены нашим открытием, что антитело р53 способно коиммунопреципитировать эндогенный р32 из лизатов клеток U2OS, полученных из остеосаркомы человека, несущих р53 дикого типа (рис. B). Чтобы более точно определить природу наблюдаемого взаимодействия, мы затем провели in vitro анализов пулл-даун с использованием бактериально-продуцируемого His-меченого p32 и GST-слитого p53.Как показано на рис. C, GST-p53 эффективно взаимодействует с His-p32, тогда как только GST этого не делает. При картировании р32-взаимодействующей области р53 связывание С-концевой области (остатки 290–393) было легко обнаружено, но N-концевая (остатки 1–83) и центральная (остатки 102–290) области не показали взаимодействия. с р32. В аналогичных экспериментах по связыванию с укороченными версиями С-концевой области р53 р32 взаимодействовал с остатками 328–368 р53, но не с остатками (остатки 284–330 и 364–393) С-концевой области р53 (рис.Д). Эти результаты подтверждают вывод о том, что первичная р32-связывающая способность р53 находится в домене тетрамеризации (остатки 328-368). В параллельных экспериментах по связыванию с GST-p32 и FLAG-меченым p53 С-концевой домен (остатки 233–282) p32 сохранял сильное сродство к p53, в то время как не наблюдалось явного взаимодействия с N-концевым (остатки 74–131) и центральные (остатки 132–232) домены р32 (рис. Д). Когда в наших анализах связывания использовались два субдомена р32, р53 эффективно связывался с остатками 233–250, но не с остатками 251–282 р32 (рис.F), что указывает на то, что небольшой субдомен в С-концевом домене р53 играет основную роль в связывании р32 с р53.

Прямое взаимодействие р32 с р53. (A) клетки h2299 трансфицировали меченными FLAG p32 и/или p53 в течение 24 часов. Экстракты готовили в буфере для лизиса и подвергали иммунопреципитации антителами против FLAG. Вестерн-блот-анализ проводили с антителом р53 для обнаружения присутствия р53. (B) Цельноклеточные лизаты были приготовлены из клеток U2OS, иммунопреципитированы антителами против р53 или контрольными IgG и проанализированы с помощью вестерн-блоттинга с антителами против р32 и анти-р53.Вход представляет собой 10% клеточных экстрактов, используемых в иммунопреципитации. ( C ) GST отдельно или указанные слияния GST-p53 были иммобилизованы на гранулах глутатион-сефарозы и инкубированы с His-меченым p32. После обширной промывки связанные белки p32 фракционировали с помощью 12% SDS/PAGE и исследовали с помощью вестерн-блоттинга с анти-His-антителами. Также показано десять процентов входных белков. Правая панель показывает схематическую иллюстрацию p53 и его делеционных мутантов, используемых в анализах. Цифрами обозначены аминокислотные остатки.(D) Анализы связывания in vitro с His-меченым p32 выполняли в основном так, как описано в (C), но С-концевые субдомены p53 использовали, как указано. (E) p53, помеченный FLAG, инкубировали с иммобилизованным GST или указанными слияниями GST-p32, и связанные белки p53 визуализировали с помощью вестерн-блоттинга с антителом против FLAG. Вход представляет собой 10% белка p32, используемого в реакциях связывания. (F) Анализы связывания in vitro с меченым FLAG p53 выполняли в основном так, как описано в (E), но использовали указанные С-концевые субдомены p32.

Чтобы идентифицировать аминокислотные остатки, критические для описанного выше интерфейса взаимодействия, мы затем создали структурную модель комплекса р32-р53, используя кристаллические структуры р32 и р53. С мономерным p53 взаимодействия вблизи вершины спиралей p32 были указаны в нашей структурной модели (рис. A). В частности, были очевидны электростатические контакты p53(Gln331)–p32(Asp249), p53(Arg333)–p32(Asp241) и p53(Arg337)–p32(Asp245) и гидрофобные взаимодействия с участием p53(Phe341). В тетрамерном р53 р53(Gln331) и р53(Arg337) взаимодействуют с р53(Asp352) через составляющие мономеры.Точно так же p53 (Phe341) скрыт в интерфейсе тетрамеризации и недоступен. Только взаимодействия p53(Gln331)–p32(Asp249) все еще кажутся возможными в соответствии с нашей моделью (рис. B). Таким образом, мы предполагаем, что p32 дестабилизирует тетрамер p53, задействуя остатки, которые образуют интерфейс тетрамеризации. В соответствии с этой точкой зрения, мы не смогли обнаружить белки р53 в иммунопреципитатах р32 из экстрактов клеток h2299, экспрессирующих р53 дикого типа и р32 с мутациями D245/D249 (рис. C). Основываясь на нашей модели, мы ожидали, что p32 (D245A) будет значительно вмешиваться во взаимодействия p32-p53, а p32 (D249A) — умеренно. Анализы связывания in vitro с использованием мутантных белков GST-p32 D245A и D249A показали, что взаимодействие p32 с p53 сильно ингибируется мутацией D245A и слабо мутацией D249A (рис. D). Мы также обнаружили, что почти полное прекращение взаимодействия p32-p53 требует замещения аланином как D245, так и D249 (Fig. D). Учитывая, что функция р32 в ослаблении трансактивации р53 включает его прямое взаимодействие с р53, мы также исследовали влияние мутаций D245 и D249 на трансрепрессивную активность р32.Для этой цели p32, p32 (D245A), p32 (D249A) и p32 (D245/249A) экспрессировали в бактериях и подвергали аффинной очистке, как описано в разделе 2.22.2 и показано на рис. S2C. Как показано на фиг. Е, репрессивный эффект р32 на трансактивацию р53 устранялся индивидуальной мутацией D245A и D249A р32. Сходным образом, добавление к реакциям р32 с мутациями D245/D249 не вызывало изменений в р53-зависимой транскрипции. В соответствии с этими данными in vitro , параллельные эксперименты по трансфекции показали, что репрессивные эффекты р32 на трансактивацию р53 устранялись мутацией D245A и/или D249A р32 (фиг.Ф). Эти данные в целом указывают на то, что взаимодействие р32-р53 сосредоточено вблизи вершины α-спиралей р32, что подтверждает опосредованный р32 коллапс тетрамеризации р53 и подтверждает, что р32 напрямую модулирует трансактивацию р53.

Влияние мутаций p32 на взаимодействие p32–p53. (А) Модель взаимодействия тримерного р32–мономерного р53. Предсказания докинга благоприятствуют контактам p53(Gln331)–p32(Asp249), p53(Arg333)–p32(Asp241) и p53(Arg337)–p32(Asp245) и гидрофобным взаимодействиям с участием p53(Phe341).(B) Модель взаимодействия тримерного p32–тетрамерного p53. Было предсказано, что p32 взаимодействует с тетрамерным p53 только через p53(Gln331)-p32(Asp249). Записи банка белковых данных 3sak (p53), 1aie (p53) и 1p32 (p32) использовали в моделировании докинга с использованием программы cluspro 2.0 (Kozakov et al., 2017; Mittl et al., 1998). Предполагалось, что структура p32-связанного мономерного p53 напоминает его структуру в тетрамерной сборке p53. (C) Экстракты цельных клеток были приготовлены из клеток h2299, экспрессирующих p53 и FLAG-меченый D245/249A-мутированный p32, и иммунопреципитированы антителом против FLAG.Вестерн-блот анализ проводили с антителом р53 для обнаружения присутствия р53 в осажденных белках. (D) GST pull-down анализы проводились, как на рис. F, но с использованием GST-p32 (233–250), несущих точечные мутации в D245 и/или D249. (E) Анализы транскрипции in vitro проводились, как описано на рис. C, за исключением того, что использовались белки p32, несущие указанные мутации. (F) клетки h2299 трансфицировали экспрессионными плазмидами, кодирующими мутанты p53 и p32, в течение 24 часов, как указано.Тотальную РНК получали из клеток и проводили RT-qPCR с использованием праймеров, специфичных для указанных генов. Уровни мРНК из каждой реакции нормализовали относительно внутреннего контроля β-актина . Показанные результаты представляют собой средние значения из трех независимых экспериментов, а значения, полученные из ложно-трансфицированных клеток, установлены на 1. Столбики погрешностей представляют стандартное отклонение.

3.3. p32 ингибирует связывание p53 с ДНК и тетрамеризацию

На основании того факта, что p32-связанные белки p53 дефектны как в ДНК, так и в транскрипции хроматина, мы предположили, что эти функциональные дефекты связаны с изменениями в ДНК-связывающей способности p53.Чтобы проверить эту возможность, 5′-биотинилированные фрагменты ДНК, содержащие p53RE, были амплифицированы с помощью ПЦР и иммобилизованы на покрытых стрептавидином парамагнитных гранулах для анализа связывания (рис. S5). Иммобилизованную на шариках ДНК p53RE инкубировали с меченым FLAG p53 в присутствии белков p32 дикого типа или мутантных белков в условиях, используемых в анализах транскрипции. Иммобилизованную ДНК отделяли от реакционной смеси, тщательно промывали буфером для связывания для удаления несвязавшихся белков и анализировали с помощью вестерн-блоттинга с антителом против FLAG.Ожидаемо, что связывание p53 с иммобилизованной ДНК p53RE было легко обнаружено в отсутствие p32 (фиг. A). Однако наблюдаемое связывание р53 почти полностью исчезало, когда к реакциям связывания добавляли р32 дикого типа. Ингибирующие эффекты p32 были обусловлены его прямым связыванием с p53, потому что мы все еще могли наблюдать стабильное связывание p53 с его ДНК RE в присутствии мутанта p32 с дефицитом связывания p53 с заменами в D245 и D249 (рис. A). Кроме того, при проверке эффектов определенных областей р32 в тех же условиях мы обнаружили, что С-концевой домен (аминокислоты 233–282) р32 достаточен для ингибирования связывания белка р53 с его ответными элементами (рис.B) — указывает на С-концевую домен-зависимую функцию p32.

Ингибирование связывания ДНК р53 и тетрамеризации р32. (A) Биотинилированный фрагмент ДНК, содержащий RE, был синтезирован и иммобилизован на магнитных гранулах, покрытых стрептавидином. FLAG-меченый p53 инкубировали с фрагментом ДНК, связанным с гранулами, в присутствии или в отсутствие His-меченого p32 дикого типа и мутанта (D245/249A). После нескольких стадий промывки связанную фракцию подвергали SDS/PAGE и обнаруживали вестерн-блоттингом.(B) Анализы связывания in vitro с иммобилизованным RE p53 выполняли в основном так же, как в (A), но мутанты с делецией p32 и С-концевой домен, несущий мутации D245/249A, использовали, как указано. (C) Белки p53 с меткой FLAG обрабатывали 0,01% глутаральдегидом в присутствии или в отсутствие p32 при 22 °C в течение 10 мин. Молярное соотношение p53 и p32 составляло 1 : 1, 1 : 2 или 1 : 4, как указано. Инактивированный нагреванием (HI) р32 использовали в молярном соотношении р53/р32 1 : 4 в контрольных реакциях. Образцы разделяли на 10% SDS/PAGE и анализировали вестерн-блоттингом с антителом против FLAG.Положения мономеров, димеров и тетрамеров указаны справа. (D) клетки h2299 трансфицировали плазмидами, кодирующими р53 и дикий/мутантный р32, в течение 24 ч, как показано в верхней части рисунка. После приготовления клеточных лизатов аликвоты (10 мкг) белковых экстрактов обрабатывали 0,02% глутаральдегидом в течение 10 минут при 22 °C. Образцы разделяли на 10% SDS/PAGE и анализировали вестерн-блоттингом с антителами анти-p53 и анти-FLAG. (E) Потенциал тетрамеризации р32 дикого типа или мутанта оценивали так же, как в (D), но с использованием клеточных лизатов (40 мкг) из клеток U2OS, трансфицированных р32 дикого типа или мутанта, в течение 24 часов.

Затем мы попытались понять, как p32 мешает трансактивной функции p53 в генах-мишенях. Поскольку р32 связывается непосредственно с доменом тетрамеризации р53, потенциальный механизм действия р32 заключается в том, что связывание р32 с р53 модулирует способность р53 к тетрамеризации. Для проверки этой возможности белки р53 инкубировали с р32 в присутствии или в отсутствие глутарового альдегида, а сшитые продукты анализировали с помощью вестерн-блоттинга. Сшивание белков р53 привело к образованию двух различных поперечно-сшитых форм с размерами, соответствующими размерам димера и тетрамера р53 (рис.С). Наш анализ также показал, что добавление возрастающих количеств р32 заметно снижает способность р53 образовывать тетрамеры в реакции. Наблюдаемые эффекты были специфическими, поскольку инактивированный нагреванием р32 не проявлял какой-либо ингибирующей активности в отношении тетрамеризации р53 (рис. C). Чтобы исследовать, оказывает ли p32 сходное действие на клеточные белки p53, клетки h2299 котрансфицировали p53 и p32 дикого типа или дефектным по взаимодействию мутантом D245/249A и перекрестно сшивали глутаральдегидом.Вестерн-блоттинг сшитых лизатов ясно показал, что коэкспрессия р32 дикого типа отменяет тетрамеризацию р53 в клетках h2299 (рис. D). Напротив, в клетках, экспрессирующих р53 и мутант р32 D245/249A, изменений в тетрамеризации р53 не наблюдалось (рис. Г). Точно так же, когда p53-положительные клетки U2OS трансфицировали p32 дикого типа, эндогенный p53 не мог образовывать димеры и тетрамеры (Fig. E). Аналогичный эксперимент также показал, что избыточная экспрессия мутанта p32, дефектного по взаимодействию p53, не оказывает никакого влияния на способность p53 к тетрамеризации (рис.E), убедительно подтверждая, что блокада тетрамеризации p53 является критическим компонентом p32-индуцированной супрессии p53.

3.4. р32 ограничивает занятость р53 в генах-мишенях

Наше открытие, что р32 взаимодействует и препятствует тетрамеризации р53, позволяет предположить, что наблюдаемые эффекты могут быть непосредственно связаны с индуцированным р32 ингибированием связывания р53 с генами-мишенями. Поэтому мы провели анализы ChIP для измерения влияния экспрессии p32 на уровни занятости p53 в генах-мишенях.Сшитый хроматин был выделен из контрольных клеток h2299 и клеток h2299, экспрессирующих p53 и/или p32, и обработан ультразвуком до моно- и динуклеосом после перекрестного связывания. Осажденную нуклеосомную ДНК экстрагировали и амплифицировали с помощью количественной ПЦР с использованием праймеров, специфичных для областей p53RE генов-мишеней. Хотя эффективность преципитации немного отличалась среди генов-мишеней, мы смогли обнаружить сигналы p53 ChIP вблизи ответных элементов в клетках, трансфицированных p53 (Fig. 1), что указывает на то, что эктопический p53 стабильно связывается с p53RE в клетках.В этих условиях анализа мы наблюдали серьезное снижение уровней р53 в генах-мишенях в ответ на экспрессию р32, подтверждая участие р32 в регуляции степени занятости гена-мишени с помощью р53. Когда эксперименты с ChIP были выполнены после экспрессии мутанта p32 D245/249A, дефектного по взаимодействию p53, также было очевидно отчетливое увеличение локализации p53 вокруг ответных элементов (Fig. 1). Эти результаты исключают возможность того, что наблюдаемые эффекты р32 вызваны перекрестной реактивностью антител с нецелевыми белками, и указывают на то, что функция р32, нацеленная на р53, действительно точно определена в наших анализах.Вместе наши данные ChIP-qPCR подтверждают представление о том, что репрессивная активность p32 в отношении трансактивации p53 возникает из-за его рестриктивных эффектов на занятость p53 генов-мишеней.

Увеличение рекрутирования и функции р53 после нокдауна р32. Хроматин получали из контрольных клеток h2299 и клеток h2299, экспрессирующих p53 и/или p32, и анализировали с помощью анализов ChIP с использованием антитела против p53. Осажденную ДНК амплифицировали с праймерами, изображенными вверху и перечисленными в таблице. Процент ввода определяется как количество иммунопреципитированной ДНК относительно введенной ДНК.Столбики погрешностей представляют стандартное отклонение, полученное из трех независимых экспериментов.

3.5. р32 способствует цитоплазматической локализации р53 путем экспорта в ядро ​​

Домен тетрамеризации р53 содержит богатый лейцином NES, который направляет р53 из ядра в цитоплазму (Stommel et al. , 1999). Когда p53 находится в тетрамерной форме, этот NES остается скрытым для ядерной функции p53. Если тетрамеризация p53 ингибируется, NES подвергается воздействию, что позволяет экспортировать p53 из ядра в цитоплазму для убиквитин-зависимой протеасомной деградации (Kamada et al., 2016; Ли и др. , 1994). Т.о., заинтригованные негативным влиянием р32 на тетрамеризацию р53, мы затем попытались оценить, играет ли р32 роль в регуляции ядерного экспорта р53. С этой целью зрелые р32 и р53 дикого типа/мутанта экспрессировались в клетках h2299 в течение 24 ч, а уровни р32 и р53 в цитоплазматической и ядерной фракциях анализировались с помощью вестерн-блоттинга. Качество цитоплазматического и ядерного фракционирования определяли по наличию во фракциях цитоплазматического тубулина и ядерного ламина.При индивидуальной экспрессии в клетках h2299 белки р53 и зрелые белки р32 располагались преимущественно в ядре и редко выявлялись в цитоплазме (рис. А). Результаты на рис. А также указывают на то, что коэкспрессия р53 с р32 приводит к значительному снижению ядерных уровней белка р53. При проверке уровней белка р53 в цитоплазме этих клеток мы обнаружили низкие уровни р53, предположительно потому, что цитоплазматические белки р53 быстро подвергались деградации, опосредованной протеасомами.Поскольку экспрессия p53 не влияла на общие клеточные уровни белка p32 (Fig. A), взаимодействие p32-p53 действует только в одном направлении и приводит к цитоплазматической транслокации и деградации p53. В параллельных экспериментах, в которых анализировали уровни р53 в клетках, трансфицированных дефектным по взаимодействию с р53 мутантом р32 D245/249A, изменений в уровне ядерного белка р53 не наблюдалось.

Стимуляция ядерного экспорта p53 с помощью p32. (A) клетки h2299 трансфицировали экспрессионными векторами для белков дикого типа и мутантных белков FLAG-p32 и HA-p53, как указано.Экстракты цельных клеток, цитоплазматические экстракты и ядерные экстракты готовили и анализировали с помощью вестерн-блоттинга с антителами против FLAG и против HA. Представленный блот является представителем трех независимых экспериментов. (B) клетки h2299 трансфицировали векторами экспрессии FLAG-p32 и HA-p53 и иммуноокрашивали антителами против FLAG и против HA. Для каждого эксперимента исследовали по 20 клеток. Показаны репрезентативные изображения иммуноокрашивания. Масштабная линейка, 20 мкм. Прилегающий график представляет количество ядерной флуоресценции p53 в каждой группе, количественно определенное изображением j 1.ПО 48В. Столбики погрешностей представляют SD.

Для дальнейшего изучения роли p32 в транслокации ядра p53 в цитоплазму мы также провели иммунофлуоресцентный анализ. На рисунке B показаны репрезентативные примеры иммуноокрашенных клеток, а также соотношение между клетками с ядерным и цитоплазматическим окрашиванием p32 и p53. Только HA-p53 демонстрировал преимущественно паттерн ядерной локализации. Кроме того, высокие уровни FLAG-p32 были распределены по всему ядру с некоторыми следами в цитоплазме.Когда клетки котрансфицировали комбинацией HA-p53 и FLAG-p32, наблюдалось значительное снижение количества клеток с ядерным p53 (рис. B). Опять же, незначительное окрашивание FLAG-p53 в цитоплазме клеток, трансфицированных p32, свидетельствует о том, что p53 подвергается деградации сразу после его экспорта в цитоплазму. Ожидаемо, что интенсивность окрашивания ядра p53 не была значительно снижена после коэкспрессии мутанта p32 D245/249A, дефектного по взаимодействию p53. Вместе эти данные дают представление о специфических регуляторных механизмах, с помощью которых р32 влияет на супрессорную функцию р53, способствуя его ядерному экспорту и деградации.

3.6. р32 ослабляет трансактивацию р53 в ответ на повреждение ДНК

Поскольку р32 препятствует тетрамеризации р53 и усиливает транслокацию р53 в цитоплазму, далее мы хотели узнать, связаны ли наблюдаемые эффекты непосредственно с индуцированным р32 подавлением трансактивации р53 в ответ на повреждение ДНК. . С этой целью мы подготовили истощенные по p32 клетки U2OS с использованием лентивирусной векторной системы. Вестерн-блоттинг и анализ RT-qPCR подтвердили, что наше инфицирование клеток U2OS лентивирусными векторами, экспрессирующими p32 shRNA, сильно подавляло экспрессию p32 в клетке (рис.С6А). Что еще более важно, при сравнении экспрессии гена-мишени p53 в ложно-истощенном контроле и клетках с истощением p32 было очевидно, что нокдаун p32 приводит к увеличению экспрессии p53-чувствительных генов (Fig. A). Поскольку этопозид индуцирует трансактивацию р53 и апоптоз из-за повреждения ДНК, мы также обработали клетки U2OS 50 мкМ этопозида в течение 12 часов и проанализировали влияние р32 на экспрессию р53 и его генов-мишеней. Как показано на рис. А, клетки, обработанные этопозидом, демонстрировали гораздо более высокие уровни экспрессии гена-мишени р53, когда р32 истощен, что указывает на негативную роль р32 в трансактивации р53 (рис.А). Эти результаты исключают возможность того, что наблюдаемые эффекты p32 shRNA вызваны нецелевой активностью, и указывают на то, что трансрепрессивная функция p32 действительно точно установлена ​​в наших анализах. В соответствии с этими наблюдениями жизнеспособность клеток U2OS, обработанных этопозидом, также значительно снизилась после стабильного нокдауна p32 (рис. S6B).

Негативная регуляция р53 р32 в ответ на повреждение ДНК. (A) Контрольные и p32-истощенные клетки U2OS подвергались имитации обработки или обработке 50 мкм этопозида в течение 12 часов.Образцы РНК готовили и анализировали с помощью RT-qPCR с использованием праймеров, специфичных для восьми генов-мишеней p53 и контрольного гена GAPDH . Значения выражены как кратность изменения уровней мРНК в неистощенных контрольных клетках. Данные представляют собой среднее ± стандартное отклонение трех независимых экспериментов. (B) Клетки U2OS обрабатывали этопозидом (50 мкм) в течение 0, 3, 6 и 12 ч, а экстракты цельных клеток, цитоплазматические экстракты и ядерные экстракты готовили и анализировали с помощью вестерн-блоттинга с анти-p53 и анти- антитела р32.Представленный блот является представителем трех независимых экспериментов. (C) После обработки этопозидом, как в (A), клетки U2OS были иммуноокрашены антителами против p32 и против p53. Для каждого эксперимента исследовали 100 клеток. Показаны репрезентативные изображения иммуноокрашивания. Масштабная линейка, 10 мкм.

С целью оценки возможной роли р32 в регуляции ядерного экспорта р53 при повреждении ДНК мы затем обработали клетки U2OS этопозидом в течение 0, 3, 6 или 12 ч и проанализировали уровни р32 и р53 в цитоплазме по сравнению с ядерные фракции в каждый момент времени вестерн-блоттингом.Как показано на рис. B, обработка этопозидом клеток U2OS приводила к прогрессивному снижению уровней ядерного р32 и увеличению цитоплазматического накопления р32. Поскольку этопозид-индуцированное повреждение ДНК лишь незначительно увеличивает общий клеточный уровень белка р32, цитоплазматическая транслокация р32 может быть критическим событием для ослабления репрессивного действия р32 против р53-опосредованной трансактивации. В параллельных экспериментах, в которых анализировали изменения уровня р53 в те же периоды времени, после обработки этопозидом было очевидно быстрое повышение уровня р53 в ядре.Было обнаружено, что низкие уровни p53 находятся в цитоплазме в течение определенного периода времени, по-видимому, из-за того, что цитоплазматические белки p53 быстро подвергаются деградации, опосредованной протеасомами. В соответствии с этими наблюдениями наше иммунофлуоресцентное окрашивание показало, что обработка клеток U2OS этопозидом в течение 12 часов значительно снижала интенсивность ядерного p32 (рис. C, левая панель). Кроме того, уровни p53 были обратно пропорциональны уровням p32 в ядрах клеток U2OS после индуцированного этопозидом повреждения ДНК (рис.С, правая панель). Вместе эти данные дают представление о специфических регуляторных механизмах, с помощью которых р32 влияет на супрессорную функцию р53, способствуя его ядерному экспорту и деградации.

4. Обсуждение

Программа транскрипции p53 является центральной темой в опосредовании клеточного ответа на широкий спектр экологических стрессов. Нарушение регуляции сигнального пути р53 связано с патогенезом рака и других заболеваний. Хотя многие усилия за последние два десятилетия были сосредоточены на прямом действии р53 во время транскрипции его гена-мишени, все больше доказательств также свидетельствует о том, что исключение из ядра и деградация р53 играют важную роль в поддержании сбалансированной передачи сигналов р53.В настоящем исследовании мы использовали определенные системы анализа in vitro и представили новые доказательства, подтверждающие, что p32 является негативным регулятором p53-зависимой транскрипции как с ДНК, так и с матриц хроматина. Важно отметить, что наши эксперименты с порядком добавления подтвердили, что p32 следует добавлять в реакции транскрипции вместе с p53 из-за его репрессивного действия, что указывает на специфическую функциональную роль p32 в нацеливании на несвязанное с ДНК свободное состояние p53. Другой аргумент в пользу того, что р32 действует как мастер-репрессор р53, исходит из наших клеточных экспериментов, показывающих, что экспрессия р32 в клетках h2299, трансфицированных р53, приводит к снижению транскрипции генов-мишеней р53.В подтверждение этих результатов р32 способен образовывать репрессивный барьер для транскрипционной активности р53 как в неповрежденных, так и в поврежденных р53-позитивных клетках U2OS. Способность р32 опосредовать репрессию р53-зависимой трансактивации зависит от его прямой ассоциации с р53, что мы продемонстрировали в серии биохимических и клеточных экспериментов. Кроме того, наши исследования мутагенеза, основанные на структурном моделировании комплекса p32–p53, показали, что D245 и, в меньшей степени, D249 имеют решающее значение для p32 в блокировании образования тетрамеров p53.Следовательно, мы смогли показать, что этих мутаций достаточно, чтобы отменить роль р32 в ингибировании транскрипционного потенциала р53 по отношению к генам-мишеням. Это первое исследование, показывающее, что p32 способен устанавливать неактивное состояние генов репарации ДНК и апоптотических генов и делает это зависимым от p53 образом.

В попытке расшифровать молекулярную основу, лежащую в основе трансрепрессивной активности р32, мы обнаружили, что р32 напрямую взаимодействует с С-концевым доменом тетрамеризации р53 и успешно конкурирует за остатки р53, которые опосредуют его тетрамеризацию.р53 наиболее эффективно связывает свои ответные ДНК-элементы в виде тетрамера, а тетрамерный р53 наиболее эффективен для трансактивации генов-мишеней. Таким образом, свойство дефектной тетрамеризации р32-связанного р53 в наших анализах перекрестного связывания также хорошо согласуется с идеей о том, что взаимодействие р32 с доменом тетрамеризации р53 блокирует способность р53 образовывать тетрамер и негативно регулирует функцию р53, активируя экспрессию Репарация ДНК и гены апоптоза. р32 является одним из немногих белков, которые препятствуют тетрамеризации р53 (Clore et al., 1995) и, насколько нам известно, мы предлагаем первую модель структурной основы этого механизма. Другой интересный результат, полученный в нашем исследовании, заключается в том, что p32-опосредованное ингибирование тетрамеризации p53 обнажает NES, встроенный в домен тетрамеризации, и запускает ядерный экспорт p53 для цитоплазматической деградации. Мы также продемонстрировали, что индуцированное этопозидом повреждение ДНК вызывает высокие уровни экспрессии р53, перемещает р32 в цитоплазму, стимулирует тетрамеризацию р53 и восстанавливает транскрипционную активность р53 в ядре.Это открытие имеет особое значение, потому что оно указывает на использование уникального механизма для связывания ядерной функции p32 с инактивацией p53 посредством ингибирования образования тетрамера, который открывает NES и позволяет получить доступ к механизму ядерного экспорта. Поскольку уровни экспрессии р32 в раковых клетках выше, чем в нормальных клетках (Chen et al. , 2009; Rubinstein et al. , 2004), наши результаты имеют значение в отношении ключевого роль р32 в отключении функции р53 при развитии рака.Таким образом, новый уровень понимания, который мы предоставляем в отношении функции p32, нацеленной на p53, обещает быть полезным для понимания онкогенеза, управляемого p32, как потенциальной новой мишени для терапии рака в будущем.

Дрожжевая модель идентифицирует ENTPD6 как ген потенциального необструктивного патогена азооспермии

  • Мадуро, М. Р. и Лэмб, Д. Дж. Понимание новой генетики мужского бесплодия. Журнал 168, 2197–205 (2002).

    Артикул Google ученый

  • Хирш А.Мужское бесплодие. BMJ 327, 669–72 (2003).

    Артикул Google ученый

  • Jarow, J. P. et al. Политика передового опыта в отношении мужского бесплодия. Журнал 167, 2138–44 (2002).

    Артикул Google ученый

  • Джароу, Дж. П., Эспеланд, М. А. и Липшульц, Л. И. Оценка пациента с азооспермией. Журнал 142, 62–5 (1989).

    КАС Статья Google ученый

  • Ярви К.и другие. Руководство CUA: обследование самцов с азооспермией. Can Urol Assoc J 4, 163–7 (2010).

    Артикул Google ученый

  • Восницер, М., Гольдштейн, М. и Харди, М. П. Обзор азооспермии. Сперматогенез 4, e28218 (2014).

    Артикул Google ученый

  • Окада, Х. и др. Полногеномная экспрессия семенников с азооспермией демонстрирует специфический профиль и вовлекает ART3 в генетическую предрасположенность.PLoS Genet 4, e26 (2008 г.).

    Артикул Google ученый

  • Астон, К. И. и Каррелл, Д. Т. Полногеномное исследование однонуклеотидных полиморфизмов, связанных с азооспермией и тяжелой олигозооспермией. Дж Андрол 30, 711–25 (2009).

    КАС Статья Google ученый

  • Наварро-Коста, П., Гонсалвес, Дж. и Планча, К. Э. Область AZFc Y-хромосомы: на перекрестке между генетическим разнообразием и мужским бесплодием.Hum Reprod Update 16, 525–42 (2010).

    КАС Статья Google ученый

  • Джонсон, А. Д. и О’Доннелл, С. Дж. База данных открытого доступа с результатами полногеномной ассоциации. BMC Med Genet 10, 6 (2009).

    Артикул Google ученый

  • Харди, Дж. и Синглтон, А. Полногеномные ассоциативные исследования и болезни человека. N Engl J Med 360, 1759–68 (2009).

    КАС Статья Google ученый

  • ван дер Сийде, М.Р., Нг, А. и Фу, Дж. Системная генетика: от GWAS до путей развития болезней. Биохим Биофиз Акта 1842, 1903–1909 (2014).

    КАС Статья Google ученый

  • Chen, D. & Gyllensten, U. Уроки и последствия ассоциативных исследований и анализов рака шейки матки после GWAS. Тенденции Жене 31, 41–54. (2014).

    Артикул Google ученый

  • Кэберляйн, М.Уроки долголетия от почкующихся дрожжей. Природа 464, 513–9 (2010).

    КАС ОБЪЯВЛЕНИЯ Статья Google ученый

  • Ботштейн Д., Червиц С.А. и Черри Дж.М. Дрожжи как модельный организм. Наука 277, 1259–60 (1997).

    КАС Статья Google ученый

  • Руководство по генетике дрожжей и молекулярной биологии. Методы Enzymol 194, 1–863 (1991).

  • Нейман А.M. Спороношение у почкующихся дрожжей Saccharomyces cerevisiae. Генетика 189, 737–65 (2011).

    КАС Статья Google ученый

  • Хартвелл, Л. Х. Нобелевская лекция. Дрожжи и рак. Biosci Rep 22, 373–94 (2002).

    КАС Статья Google ученый

  • Мирзаи, Х., Суарес, Дж. А. и Лонго, В. Д. Ограничение белков и аминокислот, старение и болезни: от дрожжей до человека.Trends Endocrinol Metab 25, 558–566 (2014).

    КАС Статья Google ученый

  • Smith, M.G. & Snyder, M. Дрожжи как модель болезней человека. Curr Protoc Hum Genet Chapter 15, Unit 15 6 (2006).

    ПабМед Google ученый

  • Styles, E., Youn, J.Y., Mattiazzi Usaj, M. & Andrews, B. Функциональная геномика в изучении полярности дрожжевых клеток: движение в правильном направлении.Philos Trans R Soc Lond B Biol Sci 368, 20130118 (2013).

  • Тардифф, Д. Ф. и др. Дрожжи обнаруживают «лекарственную» сеть Rsp5/Nedd4, которая снижает токсичность альфа-синуклеина в нейронах. Наука 342, 979–83 (2013).

    КАС ОБЪЯВЛЕНИЯ Статья Google ученый

  • Mattiazzi, M., Petrovic, U. & Krizaj, I. Дрожжи как модельный эукариот в токсинологии: подход функциональной геномики к изучению молекулярной основы действия фармакологически активных молекул.Токсикон 60, 558–71 (2012).

    КАС Статья Google ученый

  • Hu, Z. et al. Полногеномное ассоциативное исследование китайских мужчин выявило три локуса риска необструктивной азооспермии. Нат Жене 44, 183–6 (2012).

    КАС Статья Google ученый

  • Hu, Z. et al. Ассоциативный анализ выявляет новые локусы риска необструктивной азооспермии у китайских мужчин.Нацкоммуна 5, 3857 (2014).

    КАС ОБЪЯВЛЕНИЯ Статья Google ученый

  • Ю. Дж. и др. Идентификация семи генов, необходимых для мужской фертильности, посредством полногеномного исследования ассоциации необструктивной азооспермии и крупномасштабного функционального скрининга, опосредованного РНК-интерференцией, у дрозофилы. Hum Mol Genet 24, 1493–503 (2014).

    Артикул Google ученый

  • Макки Б.Д., Ян, Р. и Цай, Дж. Х. Мейоз у самцов дрозофилы. Сперматогенез 2, 167–184 (2012).

    Артикул Google ученый

  • Hollingsworth, N.M., Ponte, L. & Halsey, C. MSH5, новый гомолог MutS, способствует мейотической реципрокной рекомбинации между гомологами в Saccharomyces cerevisiae, но не репарации несоответствия. Гены Дев 9, 1728–39 (1995).

    КАС Статья Google ученый

  • Почарт, стр., Уолтеринг, Д. и Холлингсворт, Н. М. Консервативные свойства между функционально различными гомологами MutS в дрожжах. J Biol Chem 272, 30345–9 (1997).

    КАС Статья Google ученый

  • Маурано, М. Т. и др. Систематическая локализация распространенных при заболеваниях вариаций в регуляторной ДНК. Наука 337, 1190–5 (2012).

    КАС ОБЪЯВЛЕНИЯ Статья Google ученый

  • Кейн С.М. и Рот, Р. Углеводный обмен во время развития аскоспор у дрожжей. J Bacteriol 118, 8–14 (1974).

    КАС пабмед ПабМед Центральный Google ученый

  • Шерман Ф. Начало работы с дрожжами. Методы Enzymol 194, 3–21 (1991).

    КАС Статья Google ученый

  • Ван, Т. Ф. и Гвидотти, Г. Гольджи локализация и функциональная экспрессия уридиндифосфатазы человека.J Biol Chem 273, 11392–9 (1998).

    КАС Статья Google ученый

  • Кассир Ю., Гранот Д. и Симхен Г. IME1, положительный ген-регулятор мейоза у S. cerevisiae. Ячейка 52, 853–62 (1988).

    КАС Статья Google ученый

  • Вершон, А. К. и Пирс, М. Транскрипционная регуляция мейоза у дрожжей. Curr Opin Cell Biol 12, 334–9 (2000).

    КАС Статья Google ученый

  • Barberis, M. Sic1 в качестве таймера циклиновых волн Clb в клеточном цикле дрожжей — принцип разработки не только ингибитора. FEBS J 279, 3386–410 (2012).

    КАС Статья Google ученый

  • Schwob, E., Bohm, T., Mendenhall, MD & Nasmyth, K. Ингибитор циклинкиназы B-типа p40SIC1 контролирует переход G1 в S в S.cerevisiae. Ячейка 79, 233–44 (1994).

    КАС Статья Google ученый

  • Бенджамин, К. Р., Чжан, К., Шокат, К. М. и Херсковиц, И. Контроль важных событий в мейозе с помощью CDK Cdc28 и специфичной для мейоза киназы Ime2. Гены Дев 17, 1524–39 (2003).

    КАС Статья Google ученый

  • Дирик Л., Гетч Л., Аммерер Г. и Байерс Б.Регуляция S-фазы мейоза с помощью Ime2 и Clb5,6-ассоциированной киназы у Saccharomyces cerevisiae. Наука 281, 1854–1857 (1998).

    КАС ОБЪЯВЛЕНИЯ Статья Google ученый

  • Гонсалес, М. и др. Скрининг дефицита GPI-закрепления гликопротеинов стенок дрожжей. Дрожжи 27, 583–96 (2010).

    КАС Статья Google ученый

  • Бернинсоне, П., Miret, JJ & Hirschberg, CB. Гуанозиндифосфатаза Гольджи необходима для транспорта GDP-маннозы в просвет везикул Saccharomyces cerevisiae Golgi. J Biol Chem 269, 207–11 (1994).

    КАС пабмед Google ученый

  • Лопес-Авалос, М. Д., Уччеллетти, Д., Абейон, К. и Хиршберг, К. Б. UDPase активность Golgi GDPase Kluyveromyces lactis играет роль в транспорте уридиновых нуклеотидов сахара в везикулы Гольджи.Гликобиология 11, 413–22 (2001).

    КАС Статья Google ученый

  • Vowels, JJ & Payne, G.S. Роль люменального домена в локализации Гольджи гуанозиндифосфатазы Saccharomyces cerevisiae. Mol Biol Cell 9, 1351–65 (1998).

    КАС Статья Google ученый

  • Ноулз, А. Ф. Суперсемейство GDA1_CD39: NTPDases с разнообразными функциями.Пуринергический сигнал 7, 21–45 (2011).

    КАС Статья Google ученый

  • Абейон, К. и др. Гуанозиндифосфатаза необходима для гликозилирования белков и сфинголипидов в просвете Гольджи Saccharomyces cerevisiae. J Cell Biol 122, 307–23 (1993).

    КАС Статья Google ученый

  • Кирли, Т.Л., Кроуфорд, П.А. и Смит, Т.М. Структура нуклеозидтрифосфатдифосфогидролаз (NTPDases), выявленная с помощью анализа мутагенного и компьютерного моделирования.Пуринергический сигнал 2, 379–89 (2006).

    КАС Статья Google ученый

  • Enyenihi, A.H. & Saunders, W.S. Крупномасштабный функциональный геномный анализ спорообразования и мейоза у Saccharomyces cerevisiae. Генетика 163, 47–54 (2003).

    КАС пабмед ПабМед Центральный Google ученый

  • Хауслер, А. и Роббинс, П. В. Гликозилирование в Saccharomyces cerevisiae: клонирование и характеристика структурного гена альфа-1,2-маннозилтрансферазы.Гликобиология 2, 77–84 (1992).

    КАС Статья Google ученый

  • Абейон, С., Орлеан, П., Роббинс, П. В. и Хиршберг, С. Б. Топография гликозилирования в дрожжах: характеристика транспорта ГДМманнозы и активности люменальной гуанозиндифосфатазы в везикулах, подобных Гольджи. Proc Natl Acad Sci U S A 86, 6935–9 (1989).

    КАС ОБЪЯВЛЕНИЯ Статья Google ученый

  • Люсье, М., Sdicu, AM & Bussey, H. Семейства маннозилтрансфераз KTR и MNN1 Saccharomyces cerevisiae. Биохим Биофиз Акта 1426, 323–34 (1999).

    КАС Статья Google ученый

  • Verma, R. et al. Фосфорилирование Sic1p с помощью G1 Cdk необходимо для его деградации и вступления в S-фазу. Наука 278, 455–60 (1997).

    КАС ОБЪЯВЛЕНИЯ Статья Google ученый

  • Фельдман Р.M., Correll, C.C., Kaplan, K.B. & Deshaies, R.J. Комплекс Cdc4p, Skp1p и Cdc53p/cullin катализирует убиквитинирование фосфорилированного ингибитора CDK Sic1p. Ячейка 91, 221–30 (1997).

    КАС Статья Google ученый

  • West, C.M. et al. Очистка и характеристика альфа-1,2,-L-фукозилтрансферазы, модифицирующей цитозольный белок FP21, из цитозоля Dictyostelium. J Biol Chem 271, 12024–35 (1996).

    КАС Статья Google ученый

  • Тада, Ю. и др. Экспрессия эктонуклеозидтрифосфатдифосфогидролазы 6 при раке яичек и яичек и ее роль в резистентности к цисплатину. Oncol Rep 26, 161–7 (2011).

    КАС пабмед Google ученый

  • Йонезава, Н. Посттрансляционные модификации белков блестящей оболочки. Adv Exp Med Biol 759, 111–40 (2014).

    КАС Статья Google ученый

  • Дойчбауэр, А. М., Уильямс, Р. М., Чу, А. М. и Дэвис, Р. В. Параллельный фенотипический анализ спорообразования и роста после прорастания Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 99, 15530–5 (2002).

    КАС ОБЪЯВЛЕНИЯ Статья Google ученый

  • Карлайл, Т. М. и Амон, А. Мейоз I устанавливается посредством трансляционного контроля циклина, специфичного для деления.Ячейка 133, 280–91 (2008).

    КАС Статья Google ученый

  • Stuart, D. & Wittenberg, C. CLB5 и CLB6 необходимы для премейотической репликации ДНК и активации мейотической контрольной точки S/M. Гены Дев 12, 2698–710 (1998).

    КАС Статья Google ученый

  • Мацуо Ю., Асакава К., Тода Т. и Катаяма С. Быстрый метод экстракции белка из делящихся дрожжей.Biosci Biotechnol Biochem 70, 1992–4 (2006).

    КАС Статья Google ученый

  • Schmitt, M.E., Brown, T.A. & Trumpower, B.L. Быстрый и простой метод получения РНК из Saccharomyces cerevisiae. Nucleic Acids Res. 18, 3091–2 (1990).

    КАС Статья Google ученый

  • CM785F Схема 15830 Top Victory Electronics (Тайвань)






     Страница 19
    Топ \nmory Electronics (Тайвань) 00., Ltd. 17-дюймовый цветной монитор FCC ID: ARSCM785F
    ПРИЛОЖЕНИЕ 3
    Конфигурация EUT и симуляторов
    Блок-схема
    Страница 20
    Top Victory Electronics (Тайвань) 00., Ltd. 17-дюймовый цветной монитор FCC ID.: ARSCM785F
    шум;
    КОНФИГУРАЦИЯ ИО И СИМУЛЯТОРОВ
    Описание ЕС Т
    Заявитель
    Производитель
    наименование товара
    Номер модели
    Идентификатор Федеральной комиссии по связи
    Горизонтальная частота
    Вертикальная частота
    Разрешение (макс.)
    Отчет TTEMC №
    Дата испытания
    : Top Victory Electronics (Тайвань) Co., Ltd.
    6F, 168, Lien Chen Road, Чун-Хо, Тайбэй
    Сянь, Тайвань, Китайская республика
    : Top Victory Electronics (Фуцзянь) 00.. ООО
    Юань Хун Роуд. Город Шан-Лу Фуцин, Фуцзянь,
    Китай.
    : 17-дюймовый цветной монитор
    : YGLr
    : ARSCM785F
    : от 30 кГц до 85 кГц
    : от 50 Гц до 130 Гц
    : 1600'1200, без чересстрочной развертки
    : TTEMC»F98164
    : 061.07 ~ 22, 1998
    Страница 21
    Top Victory Electronics (Taiwan) Co., Ltd. 17-дюймовый цветной монитор FCC ID.: ARSCM785F
    Описание симуляторов
    @ Персональный компьютер
    Номер модели: 81 ОВВ
    Серийный номер: TA43400565
    Идентификатор Федеральной комиссии по связи: A09-81XWW
    Производитель : Диджитал
    Карта VGA (EUT): Matrox, M/N MGA-MILI2+. СИН ААЕОО702
    Идентификатор ФКС. |D7057600
    @ Клавиатура
    Номер модели: ETC-5139
    Серийный номер: 733304241
    Идентификатор FCC: E5XKBM111
    Производитель: BehaviorTech Computer [email protected] Принтер
    Номер модели: 2225C+
    Серийный номер: 3007868643
    Идентификатор Федеральной комиссии по связи: DSIBXU2225
    Производитель: Хьюлет Паккард
    @ Модель №1
    Номер модели: DM-1414
    Серийный номер: 980034390
    Идентификатор FCC: lFAXDM1414
    Производитель: Асекс
    @ Модель №2
    Номер модели: DM-1414
    Серийный номер: 980034388
    Код FCC: lFAXDM1414
    Производитель 2 Aceex
    @ Мышь
    Номер модели: М—535
    Серийный номер: LZA82103129
    Идентификатор ФКС: DZL211029
    Производитель: Logitech
    Страница 22
    Top Victory Electronics (Тайвань) C0, 17-дюймовый цветной монитор с идентификатором FCC ID: ARSCM785F
    ===———=———=
    Блок-схемы
    (Подробности см. на следующей странице)
    Идентификатор ФКС.Я ARSCM7B5F
    17-дюймовый цветной монитор
    (Тайвань) Ко, Лтд.
    Лучшая электроника победы
    117142 —f-’l- 2.
    «2 мс»: 32 .i‘§.:d.\
    4:. 9м? ах СП.)
    д: 245” а:
    (Это
    "Я,
    [Д
    эйииоу '
    .5
    Ли видит
     

    %PDF-1.3 % %eCopy-1.1 % Описание страницы > 1 0 объект > эндообъект 2 0 объект > эндообъект 3 0 объект > эндообъект 4 0 объект > /Шрифт > /ProcSet [/PDF /текст /ImageB /ImageC] >> эндообъект 7 0 объект > эндообъект 8 0 объект > эндообъект 9 0 объект > эндообъект 6 0 объект > /ColorSpace /DeviceGray /Декодировать [0 1 ] /Длина 53472 >> поток R>S?}@[email protected]%-Nfq4b%aB .~DEaB 0jUaBa&-ADDCij+ЧaS a8|DCNAaZSR4{a5M*s#=*-t[)%5S», 5k

    Исследования и передовые технологии для цифровых библиотек

    ‘) var head = document.getElementsByTagName(«head»)[0] var script = document.createElement(«сценарий») script.type = «текст/javascript» script.src = «https://buy.springer.com/assets/js/buybox-bundle-52d08dec1e.js» script.id = «ecommerce-scripts-» ​​+ метка времени head.appendChild (скрипт) var buybox = document.querySelector(«[data-id=id_»+ метка времени +»]»).parentNode ;[].slice.call(buybox.querySelectorAll(«.вариант-покупки»)).forEach(initCollapsibles) функция initCollapsibles(подписка, индекс) { var toggle = подписка.querySelector(«.цена-варианта-покупки») подписка.classList.remove («расширенный») var form = подписка.querySelector(«.форма-варианта-покупки») если (форма) { вар formAction = form.getAttribute(«действие») document.querySelector(«#ecommerce-scripts-» ​​+ timestamp).addEventListener(«load», bindModal(form, formAction, timestamp, index), false) } var priceInfo = подписка.селектор запросов(«.Информация о цене») var PurchaseOption = toggle.parentElement если (переключить && форма && priceInfo) { toggle.setAttribute(«роль», «кнопка») toggle.setAttribute(«tabindex», «0») toggle.addEventListener («щелчок», функция (событие) { var expand = toggle.getAttribute(«aria-expanded») === «true» || ложный переключать.setAttribute(«расширенная ария», !расширенная) form.hidden = расширенный если (! расширено) { покупкаOption.classList.add(«расширенный») } еще { покупкаOption.classList.remove(«расширенный») } priceInfo.hidden = расширенный }, ложный) } } функция bindModal (форма, formAction, метка времени, индекс) { var weHasBrowserSupport = окно.выборка && Array.from функция возврата () { var Buybox = EcommScripts ? EcommScripts.Buybox : ноль var Modal = EcommScripts ? EcommScripts.Modal : ноль if (weHasBrowserSupport && Buybox && Modal) { var modalID = «ecomm-modal_» + метка времени + «_» + индекс var modal = новый модальный (modalID) модальный.domEl.addEventListener(«закрыть», закрыть) функция закрыть () { form.querySelector(«кнопка[тип=отправить]»).фокус() } вар корзинаURL = «/корзина» var cartModalURL = «/cart?messageOnly=1» форма.setAttribute( «действие», formAction.replace(cartURL, cartModalURL) ) var formSubmit = Buybox.перехват формы отправки ( Buybox.fetchFormAction(окно.fetch), Buybox.triggerModalAfterAddToCartSuccess(модальный), функция () { form.removeEventListener («отправить», formSubmit, false) форма.setAttribute( «действие», formAction.replace(cartModalURL, cartURL) ) форма.представить() } ) form.addEventListener («отправить», formSubmit, ложь) document.body.appendChild(modal.domEl) } } } функция initKeyControls() { document.addEventListener («нажатие клавиши», функция (событие) { если (документ.activeElement.classList.contains(«цена-варианта-покупки») && (event.code === «Пробел» || event.code === «Enter»)) { если (document.activeElement) { событие.preventDefault() документ.activeElement.click() } } }, ложный) } функция InitialStateOpen() { var узкаяBuyboxArea = покупная коробка.смещениеШирина -1 ;[].slice.call(buybox.querySelectorAll(«.опция покупки»)).forEach(функция (опция, индекс) { var toggle = option.querySelector(«.цена-варианта-покупки») var form = option.querySelector(«.форма-варианта-покупки») var priceInfo = option.querySelector(«.Информация о цене») если (allOptionsInitiallyCollapsed || узкаяBuyboxArea && индекс > 0) { переключать.setAttribute («ария-расширенная», «ложь») form.hidden = «скрытый» priceInfo.hidden = «скрытый» } еще { переключить.щелчок() } }) } начальное состояниеОткрыть() если (window.buyboxInitialized) вернуть window.buyboxInitialized = истина initKeyControls() })()

    записей об арестах в Окленде, Калифорния | Местные криминальные новости

    Local Crime News ежедневно обновляет информацию об арестах во всех городах Калифорнии.

    Бартли

    Ричард


    Бартли Возраст: 56 – Окленд, Калифорния

    Округ: Contra Costa
    Сообщено: 05 апреля 2022 г.
    Арестован:

    11377(A)…

    копает

    Луи


    Диггс Возраст: 38 – Окленд, Калифорния

    болинг

    Патриция


    Болинг Возраст: 43 – Окленд, Калифорния

    Округ: Contra Costa
    Сообщено: 05 апреля 2022 г.
    Арестовано для:

    WARRANT…

    Перес

    Мойзес Г.


    Перес Возраст: 21 – Окленд, Калифорния

    шатцингер

    Мэтью Р.


    Шатцингер Возраст: 44 – Окленд, Калифорния

    принты

    Кристалл Э.


    Принс Возраст: 44 – Окленд, Калифорния

    Округ: Сан-Франциско
    Сообщено: 05 апреля 2022 г.
    Арестован для:

    23152(A)…

    Хюинь Чыонг

    Джау Рокки В.


    Хюинь Чыонг Возраст: 27 – Окленд, Калифорния

    дель Сид Вильянуэва

    Хосе А.


    Дель Сид Вильянуэва Возраст: 29 – Окленд, Калифорния

    Коллинз

    Фредерик Б.


    Коллинз Возраст: 37 – Окленд, Калифорния

    бонилья гвардадо

    Диана


    Бонилья Гуардадо Возраст: 25 – Окленд, Калифорния

    лопес

    Хесус Н.


    Лопес Возраст: 59 – Окленд, Калифорния

    ТЕОДОР

    Джонсон


    Теодор Возраст: 52 – Окленд, Калифорния

    Округ: Аламеда
    Сообщено: 05 апреля 2022 г.
    Арестован:

    484(A)…

    АГУИЛАР

    Эдгар


    Агилар Возраст: 22 – Окленд, Калифорния

    ЭНДРЮС

    Скотт


    Эндрюс Возраст: 60 – Окленд, Калифорния

    Округ: Аламеда
    Сообщено: 05 апреля 2022 г.
    Арестован:

    422…

    ЦЕФАС

    Лонни


    Цефас Возраст: 39 – Окленд, Калифорния

    Округ: Аламеда
    Сообщено: 05 апреля 2022 г.
    Арестован:

    459…

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован.