Подогреватель для: 7 лучших подогревателей для бутылочек — Рейтинг 2020 года (Топ 7)

Содержание

7 лучших подогревателей для бутылочек — Рейтинг 2020 года (Топ 7)

Электрический подогреватель детского питания призван облегчить будни родителей малыша. И действительно, в нужный момент иметь под рукой теплую водичку, молоко или детское питание очень удобно. Преимущество подогревателя состоит в плавном и бережном увеличении температуры, исключающем перегрев, что позволяет сохранить в питании витамины и другие полезные вещества. Современные подогреватели для бутылочек способны не только быстро подогреть, но и сохранить тепло в течение длительного времени.

Как выбрать хороший подогреватель для бутылочек?

Конструкция подогревателя для бутылочек несложная – это пластиковая чаша, в которую встроен нагревательный элемент. Температура регулируется с помощью рукоятки-реле или кнопок. Принцип работы тоже предельно прост – вода в чаше нагревается, передавая тепло содержимому бутылочки или баночки.

Лучшие подогреватели для бутылочек имеют простое и четкое управление, отличаются быстрым и равномерным наращиваем температуры, защищены от перегрева с помощью различных функций. Важно учесть и такие нюансы при выборе:

  • управление у большинства моделей механическое, но встречаются и цифровые варианты с дисплеем и сенсорными кнопками;
  • необходимо обратить внимание на размеры чаши – некоторые модели рассчитаны на использование бутылочек только своего бренда, другие могут в них не вместиться;
  • наличие разных режимов подогрева или регулятора температуры позволяет задавать нужную температуру;
  • некоторые варианты можно использовать для разогрева замороженного молока – обычно это указывается в инструкции производителя;
  • автооотключение – полезная функция, помогающая контролировать температуру питание и случайно не перегреть его;
  • термодатчик позволяет поддержать температуру на уровне заданной в течение длительного времени;
  • индикация процесса подогрева – обычно световая, но встречается и звуковая.

Очень часто прибор сочетает в себе функции подогревателя и стерилизатора. В таких моделях возможен нагрев до 100 градусов, а в комплектацию входит крышка и лифт-подъемник.

Важным критерием является и доступная цена: принимая во внимание недолгий срок использования, нет смысла переплачивать за излишне дорогостоящий прибор.

Лучшие производители детских подогревателей

Всех производителей можно разделить на две большие группы:

  • брендовые модели известных фирм: Philips Avent, Pigeon, Dr. Brown's и др. Они заметно выделяются презентабельным внешним видом, высоким качеством материалов, разнообразием режимов и дополнительных функций. Однако и цена таких изделий довольно высока. Хотя есть и исключения, например, немецкий бренд Beurer, сочетающий технологичные решения с гуманной ценой;
  • бюджетные варианты: Maman, Kitfort, Balio и др. Как правило, имеют упрощенный функционал и дизайн, но также хорошо справляются со своей основной обязанностью. Однако у недорогих приборов чаще встречается нечеткость управления, перегрев, невысокое качество пластика и внезапные поломки.

Увы, 100% идеала мы не нашли ни в одной из групп. Отчасти это объясняется тем, что требования у всех мам разные, а быстрого подогрева в воде до заданной температуры добиться не так просто. Впрочем, качественных подогревателей с достойными параметрами не так уж мало, и мы познакомим вас с ними в нашем рейтинге.

В нашем рейтинге мы рассмотрели несколько качественных подогревателей бутылочек и детского питания. Все они имеют особенности эксплуатации, положительные свойства и недостатки, но достойно выполняют свои основные функции и облегчают родителям ежедневную рутину. Выбор за вами!

Подогреватель для бутылочек цифровой

Здравствуйте, меня зовут Александра и недавно мне и моей семье посчастливилось стать участниками тест-драйва Подогревателя для бутылочек/баночек от Chicco.

У нас двое сыновей, старшему Мишеньке почти 1,9, а младшему Ромику недавно исполнилось 3 месяца. Я активная мама и жена, и дорожу своим временем и комфортом, потому лучше потрачу свободное время на игры с детьми, чем потеряю его на кипячении чайника, ожидании подогревания бутылочки с молоком или баночки с детским питанием, а возможно и ожидании остывания, если вовремя не успеешь или забудешь остановить прогревание.

Я знаю о чем говорю, потому что со старшим сыном мы были на смешанном вскармливании и были вынуждены рано ввести прикорм, но все не решались приобрести подогреватель, а потом вроде и привыкли, да и после года перешли на общий стол, что позволило разогревать пищу на газовой плите или в микроволновой печи. Но тем не менее до сих пор нужно подогревать Мишуньке и творог, и фруктовое пюре, сок или компот, так как он еще слишком мал, чтоб употреблять напитки и еду сразу из холодильника. И вот, 13.10.15 пришел наш долгожданный подогреватель. 

Как видите, все было очень аккуратно упаковано. В коробке находился сам подогреватель, адаптер питания,держатель для бутылочек/баночек и инструкция по эксплуатации. Первое впечатление подогреватель Chicco произвел замечательное. Он стильный, компактный, поместится на любой кухне и несомненно станет украшением даже самого смелого интерьера. Прежде чем приступить к использованию следует прочесть краткую и доступную в понимании инструкцию, на первой странице которой изображена схема частей и расположения кнопок подогревателя. 

В описании подогревателя указано, что он подходит для большинства бутылочек и баночек, имеющихся на рынке детских товаров. Как думаю и у любой мамы, у меня есть бутылочки, контейнеры для молока и баночки детского питания разных производителей. Баночки сейчас используются для специй, так как Мишенька уже ест с общего стола, а Ромику прикорм еще не введен, но проверке это не помешало. И подогреватель Chicco полностью оправдал ожидания.

          

На фото представлены бутылочки трех разных производителей, контейнер для хранения молока и баночки из под детского питания двух разных марок. Бутылочку Chicco проверять не стала, так она несомненно идеально подойдет по параметрам к подогревателю. Кстати, поильники тоже прекрасно помещаются в держатель, что позволяет подогреть сок, компот, чай или просто водичку до комфортной для ребенка температуры.

          Время получения подогревателя для бутылочек Chicco совпало с полдником старшего сынули и я решила подогреть ему творожок. Мы уже не покупаем детский творог в упаковках, а берем на развес, потому я переложила необходимое количество (100г) в контейнер для молока и поместила его в держатель для бутылочек и баночек. По инструкции при исходной температуре 5' (средняя температура холодильника) и объеме бутылочки до 150 мл, в подогреватель следует налить 20 мл воды, после чего подключить шнур питания. 

      После включения подогревателя Chicco в сеть, издается характерный звук, выбрать же программу можно после кратковременного нажатия на кнопку вкл/выкл, после чего уже загорается дисплей и начинает мигать красным светом основная кнопка. Так как мне нужно было некоторое время до начала кормления, я решила сразу проверить и функцию таймера. Я выбрала нужный мне объем бутылочки, исходную температуру продукта и отсрочила программу подогревания на 15 минут, в которые входят 10 минут ожидания и 5 минут на подогрев.

 

           Вернулась я к подогревателю спустя 11 минут, о чем оповестил меня дисплей, показав, что до окончания программы осталось 4 минуты и уже начав подогревать творожок. 

         На протяжении всей программы подогрева  кнопка вкл/выкл мигает красным светом, последняя минута отображается посекундно. 

           После окончания программы раздается характерный звук, приятный уху,который можно уловить, но при этом он не потревожил чуткий сон Ромика.   Для сравнения, у меня имеется пароварка, которая может и соседей разбудить. А так же, у подогревателя Chicco для бутылочек, загорается синий свет кнопки включения, дав знать о том, что подогрев завершен. 

           Перемешав творог, я отметила, что он получился очень мягким и нежным, температура его соответствовала комнатной, для деток помладше можно запустить еще один цикл, и тогда он прогреется до положенных 37', что очень удобно, так как старший сынулька уже не будет есть теплый творожок. Т.е при подогревании питания, только что извлеченного из холодильника, вы добьетесь комнатной температуры, а при подогреве, например сцеженного, и постоявшего минут 30 - 50 при комнатной температуре, молока, вы получите необходимые 37'.  

          Добавляем к творогу пару ложек перетертых с сахаром слив со своего огорода и вкусный полдник готов!

        Функцию подогрева сцеженного молока из холодильника и бережной разморозки молока из морозильной камеры проверил мой муж. Так как Ромик за кормление съедает 120мл молока, то муж воспользовался той же программой, что и я, только без использование таймера, указав, что времени подогревания идеально хватает для смены подгузника. =) А размораживая молоко (300мл), ему четко хватило времени, указанного в инструкции, а именно 25 минут, что позволяет успеть разморозить молоко, даже за самый короткий сон малыша. В дальнейшем, когда введем сынишке прикорм, используем и возможность подогревать детское питание прямо в баночке. По итогу, муж остался очень доволен, сказал, что подогреватель Chicco бесконечно облегчает жизнь молодым папам, оставшимся с маленькими детьми по тем или иным причинам, а так же, как очень требовательный к технике мужчина,  оценил функциональность и удобство использования подогревателя для бутылочек и баночек на 5+. 

        После использования, подогреватель очень быстро остывает, что позволяет в максимально короткие сроки, помыть и просушить его.

Удобная конструкция, не содержащая бесчисленное количество разборных частей и деталей, так же облегчает процесс чистки. Профилактику от накипи, по инструкции, следует проводить уксусным раствором, что весьма упрощает жизнь молодым мамам и хозяйкам, так как уксус найдется на любой кухне. 

        Из недостатков могу отметить только один, и то незначительный. Возможно очень требовательным мамам будет нехватать мерной емкости, для определения необходимого количества воды для каждой программы подогревания питания. Но, например у меня, подобная емкость есть у стерилизатора, именно она и была использована мной и мужем. Так же думаю у многих найдутся подобные мерные стаканчики для использования на кухне, или от других бытовых приборов. Можно воспользоваться бутылочкой, контейнером для молока или поильником, а на крайний случай есть столовая ложка, которой можно отмерить 20-25 мл воды. 

         Подводя черту, могу сказать, что я очень рада, что Chicco доверил мне тестирования данного продукта. Подогреватель подтвердил все, заявленные в описании возможности, и стал для нас драгоценным подарком. Он станет незаменимым помощником и другом для каждой мамы на протяжении длительного времени, а так же превосходным презентом для друзей и близких, которые находятся в ожидании малыша или недавно стали родителями. Будь то семьи, чей ребенок на искусственном вскармливании, или на грудном или смешанном, подогреватель Chicco для бутылочек и баночек станет верным слугой, и обретет свое место в доме и сердцах в каждой семье. 


Назад к товару

Быстрый подогреватель бутылочек SCF355/00 | Avent

Быстрый подогреватель бутылочек SCF355/00 | Avent

Philips Avent

Быстрый подогреватель бутылочек

SCF355/00

Электрический подогреватель для быстрого разогрева

Если вы устали, подогреватель бутылочек Philips Avent разогреет молоко быстро и равномерно всего за 3 минуты. Простой в использовании прибор с функцией размораживания также подходит для подогрева детского питания. Узнать обо всех преимуществах

Если вы имеете право на льготы по НДС для медицинских устройств, вы можете воспользоваться ими при покупке этого продукта. НДС будет вычтен из цены, указанной выше. Подробную информацию см. в корзине.

Philips Avent Быстрый подогреватель бутылочек

Электрический подогреватель для быстрого разогрева

Если вы устали, подогреватель бутылочек Philips Avent разогреет молоко быстро и равномерно всего за 3 минуты. Простой в использовании прибор с функцией размораживания также подходит для подогрева детского питания. Узнать обо всех преимуществах

Электрический подогреватель для быстрого разогрева

Если вы устали, подогреватель бутылочек Philips Avent разогреет молоко быстро и равномерно всего за 3 минуты. Простой в использовании прибор с функцией размораживания также подходит для подогрева детского питания. Узнать обо всех преимуществах

Если вы имеете право на льготы по НДС для медицинских устройств, вы можете воспользоваться ими при покупке этого продукта. НДС будет вычтен из цены, указанной выше. Подробную информацию см. в корзине.

Philips Avent Быстрый подогреватель бутылочек

Электрический подогреватель для быстрого разогрева

Если вы устали, подогреватель бутылочек Philips Avent разогреет молоко быстро и равномерно всего за 3 минуты. Простой в использовании прибор с функцией размораживания также подходит для подогрева детского питания. Узнать обо всех преимуществах

Электрический подогреватель для быстрого разогрева

Подогревает молоко быстро и равномерно

  • Равномерный подогрев без перегрева
  • Быстрый подогрев
  • Бережная разморозка
  • Подходит для подогрева детского питания

Поддержание температуры

После медленного подогрева температура молока или детского питания будет поддерживаться на оптимальном уровне до нужного момента.

Совместимость с бутылочками и контейнерами Philips Avent

Подогреватель бутылочек полностью совместим со всеми бутылочками и контейнерами Philips Avent*. Используйте его для удобного подогрева содержимого бутылочек и контейнеров.

Показать все функции Показать меньше функций

Показать все Функции устройства Показать меньше Функции устройства

Технические характеристики

  • Этапы взросления

    Этап

    Все

    напряжение

    220–240 В, 50–60 Гц

    Размеры изделия (ШxВxГ)

    160,4 x 139,9 x 148,55  миллиметра

    Размеры потребительской упаковки (Ш x В x Г)

    175 x 185 x 160  миллиметра

  • В комплект входят:

    Подогреватель бутылочек

    1  шт.

    Разработано:

    Европа

    потребляемая мощность

    300  Вт

    Классификация по степени безопасности

    1 класс

    Произведено:

    Китае

  • Материал изделия

    АБС-пластик

    Да

    PP

    Да

Просмотреть все спецификации См. Меньше спецификаций

Показать все Технические характеристики Показать меньше Технические характеристики

Предлагаемые продукты
Недавно просмотренные продукты

{{{sitetextsObj. prominentRating}}}

написать отзыв

{{{sitetextsObj.totalReview}}} {{{sitetextsObj.recommendPercentage}}}

    {{#each ratingBreakdown}}
  • {{ratingValue}} Только отзывы с оценкой {{ratingValue}} зв.
  • {{/each}}

написать отзыв

    {{#each userReviews}}
  • {{this.UserNickname}} {{date this.SubmissionTime ../this.dateFormat}}

    {{#if this.Badges}} {{#if this.Badges.incentivizedReview}}

    Часть продвижения Этот рецензент получил вознаграждение за написание этого обзора. Вознаграждение может быть купоном, образцом продукта, билетом на участие в розыгрыше, баллами лояльности или иным ценным призом, выдаваемым за написание обзора на этот продукт.

    {{/if}} {{#if this.Badges.Expert}}

    Мнение эксперта Этот отзыв был написан экспертом индустрии после тестирования продукта, предоставленного Philips

    {{/if}} {{/if}}

    {{this.Title}}

    {{this.ReviewText}}

    {{#if this.IsRecommended}}

    Да, я рекомендую этот продукт

    {{/if}}
  • {{/each}}
{{this.UserNickname}} {{#with ContextDataValues}}
    {{#iff Gender 'and' Gender.Value}} {{#iff Gender.Value 'eq' 'Male'}}
  • мужчина
  • {{/iff}} {{#iff Gender.Value 'eq' 'Female'}}
  • Женщина
  • {{/iff}} {{/iff}} {{#iff Age 'and' Age.ValueLabel}}
  • Возраст  {{Age.ValueLabel}}
  • {{/iff}} {{#iff HowManyPeopleLiveInYourHousehold 'and' HowManyPeopleLiveInYourHousehold.ValueLabel}}
  • {{{replaceString 'Членов семьи: {number}' '{number}' HowManyPeopleLiveInYourHousehold.ValueLabel}}}
  • {{/iff}}
  • {{{replaceString 'Голосов: {number}' '{number}' . ./TotalFeedbackCount}}}
{{/with}} {{date this.SubmissionTime ../this.dateFormat}} {{#if this.Badges}} {{#if this.Badges.verifiedPurchaser}}

Проверенный покупатель

{{/if}} {{#if this.Badges.incentivizedReview}}

Часть продвижения Этот рецензент получил вознаграждение за написание этого обзора. Вознаграждение может быть купоном, образцом продукта, билетом на участие в розыгрыше, баллами лояльности или иным ценным призом, выдаваемым за написание обзора на этот продукт.

{{/if}} {{#if this.Badges.Expert}}

Мнение эксперта Этот отзыв был написан экспертом индустрии после тестирования продукта, предоставленного Philips

{{/if}} {{/if}}

{{this.Title}}

{{this.ReviewText}}

{{#if this.IsRecommended}}

Да, я рекомендую этот продукт

{{/if}} {{#if this.AdditionalFields.Pros}} {{#with this.AdditionalFields.Pros}}

Достоинства:

{{Value}}

{{/with}} {{/if}} {{#if this.AdditionalFields.Cons}} {{#with this.AdditionalFields.Cons}}

Недостатки:

{{Value}}

{{/with}} {{/if}} {{#iff Photos.length 'or' Videos.length}}
    {{#each Videos}} {{#if VideoId}}
  • {{#if VideoThumbnailUrl}} {{else}} {{/if}}
  • {{/if}} {{/each}} {{#each Photos}} {{#iff Sizes 'and' Sizes.normal}} {{#if Sizes.normal.Url}}
  • {{/if}} {{/iff}} {{/each}}
{{/iff}} {{#if IsSyndicated}} {{#iff SyndicationSource 'and' SyndicationSource.Name}}

{{{replaceString 'Оригинальная запись на {domain}' '{domain}' SyndicationSource.Name}}}

{{/iff}} {{/if}} {{#if this.ClientResponses}} {{#each this.ClientResponses}}

Ответ от Philips

{{Department}} {{date Date . ./../../dateFormat}}

{{Response}}

{{/each}} {{/if}}

Был ли этот отзыв полезен? Да / Нет

Да • {{TotalPositiveFeedbackCount}} Нет • {{TotalNegativeFeedbackCount}}

Вы действительно хотите сообщить о нарушении правил этим пользователем? Сообщить / Отмена

{{/each}}
  • При использовании 150 мл молока (или меньше) при температуре 20 °C, для бутылочки Philips Avent серии Classic/Natural 260 мл.
  • Этот подогреватель бутылочек не подходит для бутылочек Philips Avent объемом 60 мл и пакетов для хранения грудного молока Philips Avent.
{{/if}} {{/iff}} {{#iff @key "eq" 'phone'}} {{#if this.phoneFlag}} {{/if}} {{/iff}} {{#iff @key "eq" 'email'}} {{#if this.emailFlag}} Послать эл. письмо {{/if}} {{/iff}} {{#iff @key "eq" 'social'}} {{#if this.whatsappFlag}} {{/if}} {{#if this.socialFlag}} {{#this}} {{#iff type "eq" 'link'}} {{/iff}} {{#iff type "eq" 'content'}} {{/iff}} {{#iff type "eq" 'script'}} {{this.label}} {{!-- Issue with Chat link due to google+ script, so commenting the same. --}} {{!--

{{{this.content}}}

--}} {{/iff}} {{/this}} {{/if}} {{/iff}} {{/each}} {{/if}} {{/iff}} {{#iff @key "eq" 'phone'}} {{#if this.phoneFlag}} {{/if}} {{/iff}} {{#iff @key "eq" 'myPhilips'}} {{#if this.myPhilipsFlag}} {{/if}} {{/iff}} {{/each}}

Выбранные продукты (0/3)

  • Добавить продукт

  • Добавить продукт

  • Добавить продукт

  • Добавить продукт

  • Обзор подогревателей для бутылочек Kitfort KT-2301 и KT-2302

    Продолжаем серию обзоров устройств, относящихся к группе детских товаров. В частности, предназначенных для облегчения процедур, связанных с детским питанием — подогревом и стерилизацией различных приспособлений для кормления младенцев — бутылочек, сосок и пустышек. Приборы эти имеют очень простую конструкцию и узконаправленную специализацию.

    Сегодня мы познакомим читателей с приборами, предназначенными для размораживания и подогрева детского питания. Молоко, детские смеси, пюре и т. п. могут при этом находиться в пластиковых бутылочках, стеклянных и металлических баночках, а также в комплектном стакане. За счет внешнего теплоносителя, разогретого до определенной температуры, подогреватели обеспечивают бережный и равномерный нагрев. По утверждению производителя, молоко и смеси в приборе не перегреваются, что важно для сохранения питательных веществ и витаминов грудного молока.

    Исходя из вышесказанного, были определены задачи тестирования: проверка соответствия заявленных температур реальным, определение скорости разогрева и оценка удобства эксплуатации в целом. Что ж, в путь!

    Kitfort KT-2301

    Подогреватель бутылочек KT-2301 можно назвать самым миниатюрным из предоставленных компанией Kitfort аппаратов. Аппарат предназначен для подогрева всего одной небольшой бутылочки или детского питания в стаканчике объемом до 170 мл.

    Характеристики
    Производитель Kitfort
    Модель KT-2301
    Тип подогреватель для бутылочек
    Страна производства Китай
    Гарантия 1 год
    Предполагаемый срок службы 2 года
    Мощность 100 Вт
    Режимы работы три: 40 °C, 70 °C, 100 °C
    Индикатор нагрева
    Тип нагревателя РТС (позистор)
    Теплоноситель вода
    Вместимость одна бутылочка для детского питания
    Максимальная высота / диаметр бутылочки 15 см / 7 см
    Материал пластик BPA free (без бисфенола А)
    Аксессуары стакан с крышечкой для подогрева детского питания
    Особенности автоматический режим поддержания температуры, отсек для хранения шнура, возможность стерилизовать соски и пустышки
    Вес 0,45 кг
    Габариты (Ш×В×Г) 12×13×15,5 см
    Длина сетевого кабеля 95 см
    Вес с упаковкой 0,54 кг
    Габариты упаковки (Ш×В×Г) 13×15×13 см
    Средняя цена
    Розничные предложения
    Комплектация

    Подогреватель бутылочек поставляется в компактной коробочке почти кубической формы. На упаковке традиционно для Kitfort размещены слоган и логотип, схематическое изображение прибора, его наименование, описание особенностей и краткий перечень технических характеристик. Коробка не оснащена ручкой для переноски, правда, размер коробочки столь невелик, что потребности в ручке попросту нет.

    Внутри коробки находилось само устройство, упакованное в полиэтиленовый пакет, и несколько документов в другом пакете — инструкция по эксплуатации, гарантийный талон и рекламные материалы.

    На первый взгляд

    Первое впечатление связано с размерами прибора — подогреватель поражает своей компактностью. Что неудивительно, т. к. рассчитан он на подогрев одной бутылочки детского питания. Конструктивно представляет собой емкость с нагревательным элементом на дне. В нижней части лицевой стороны корпуса находится регулятор температурных режимов и индикатор нагрева.

    Пластиковая вставка на дне скрывает нагревательный элемент. На стенке чаши имеется пометка объема воды в 110 мл. Забегая вперед, скажем, что именно столько воды рекомендуется заливать в чашу для подогрева бутылочек, баночек или при использовании комплектного стакана.

    Со стороны дна размещен отсек для хранения шнура. При подготовке к включению, шнур вкладывается в специально выделенный паз в основании и выходит с задней стороны корпуса.

    Сверху чаша может быть накрыта крышечкой. Это необходимо при использовании стаканчика для подогрева детского питания или стерилизации.

    Стаканчик изготовлен из полупрозрачного пластика пастельного голубого цвета. Объем составляет 170 мл. Отметок объема на стенках нет.

    Как видим, конструкция очень простая, если не сказать примитивная. Однако качество изготовления прибора можем признать высоким. Приятный цвет, обтекаемая форма, качественный гладкий пластик, не издающий никакого запаха, компактный размер — что еще требуется прибору, пользоваться которым придется совсем недолго.

    Инструкция

    Документ формата А5 напечатан на качественной плотной бумаге. На десяти страницах пользователь имеет возможность ознакомиться с предназначением прибора, с описанием конструкции, правилами эксплуатации, техническими характеристиками и мерами предосторожности.

    Все сведения и рекомендации изложены простым языком, не перегруженным техническими терминами. Информация об эксплуатации разделена на три части в зависимости от операции: подогрев бутылочек с детским питанием, подогревание баночки или стакана с детским питанием, стерилизация сосок и пустышек. Советы помогут сориентироваться со временем работы, избежать затруднений и оптимизировать процессы. Однократного изучения инструкции, на наш взгляд, достаточно для успешного использования подогревателя.

    Управление

    Управляет работой прибора один переключатель, расположенный с лицевой стороны корпуса. Переключатель может находиться в четырех положениях: Off, 40 °C, 70 °C и 100 °C. Ход регулятора свободный, при вращении нужно установить указатель напротив требуемого положения. Каждый из шагов сопровожден рисунком, в котором без труда угадывается предназначение режима: подогрев бутылочки со смесью и подогрев детского питания.

    Во время работы нагревательного элемента индикатор горит оранжевым цветом. Если находиться рядом с прибором, то индикатор виден очень плохо: светит неярко, расположен под регулятором в сужающейся части основания. С расстояния в пару шагов можно без труда различить, горит лампочка индикатора или нет.

    Эксплуатация

    Перед первым использованием инструкция рекомендует налить в чашу подогревателя воду, включить его в режим стерилизации, накрыть крышкой от стакана и подождать, пока вода закипит. Затем нужно выключить прибор, слить воду и повторить операцию еще 4-5 раз. При первой стерилизации возможно помутнение воды — это не является дефектом. Однако в нашем случае ни помутнения, ни запаха замечено не было. 4-5 раз мы операцию также не повторяли, ограничившись перед первым использованием единственным циклом стерилизации.

    Порядок действий при использовании режимов подогрева детского питания одинаков. Для подогрева бутылочки детской смеси, баночки с пюре или детским питанием, выложенным в комплектный стаканчик, нужно налить в чашу прибора около 110 мл воды. Затем поместить туда же бутылочку, баночку или стаканчик, установить термостат на 40 °C и ждать. Инструкция говорит, что когда вода в подогревателе достигнет установленной температуры, индикатор погаснет, и бутылочку можно извлекать. По факту же индикатор гаснет очень быстро. Потом через некоторое время включается, затем опять гаснет. В итоге мы рекомендуем ориентироваться не на индикатор, а на рекомендации инструкции: для подогрева 90 мл молока требуется приблизительно 10 минут.

    Для более равномерного нагрева уровень воды в чаше должен быть слегка выше или равен уровню детского питания в бутылочке, баночке или стакане. Максимально допустимый уровень воды при этом составляет не менее 1 см до края чаши.

    Перед тем, как кормить малыша, необходимо встряхнуть молоко или молочную смесь и проверить температуру. Детское питание следует перемешать и также проверить степень нагрева. Если температура недостаточна, то следует вернуть емкость назад в подогреватель.

    Не следует долго держать детское питание в режиме подогрева, поскольку продукт может испортиться. Для изготовления молочной смеси или каши рекомендуется держать в подогревателе бутылочку с водой в режиме поддержания температуры, а смесь добавлять непосредственно перед кормлением.

    Процесс стерилизации столь же прост. Налить все те же 110 мл воды, закинуть соски или пустышки, накрыть прибор крышкой и задать режим стерилизации, переместив термостат в положение 100 °C. После того, как вода закипит, стерилизовать аксессуары следует не более двух минут.

    В конце работы нужно перевести регулятор в положение Off, отключить прибор от сети и слить из чаши воду. Перед следующим циклом работы необходимо дать прибору несколько минут для остывания.

    Уход

    Уход за устройством крайне прост. В конце работы нужно отключить его от сети и слить воду. Затем можно протереть внешнюю и внутреннюю части влажной тканью. Стакан и крышку можно мыть водой с мылом. Корпус подогревателя запрещено погружать под воду или мыть его под струей воды.

    При регулярном использовании подогревателя раз в месяц нужно производить очистку от накипи. Для этого в чашу следует залить 50 мл уксуса и 100 мл холодной воды, включить подогреватель в сеть и задать режим 40 °C. Подождать 10 минут и выключить прибор. Смесь должна находиться в чаше до полного растворения известкового налета, после чего ее нужно слить и тщательно промыть чашу.

    Тестирование

    Наши измерения

    Мощность подогревателя Kitfort KT-2301 во время работы нагревателя колеблется от 118 до 124 Вт, что слегка превышает заявленную производителем мощность в 100 Вт.

    100 мл холодной воды из-под крана закипели за 6 минут 20 секунд. Никакого шума прибор во время работы не издает.

    Практические тесты

    Во время практических экспериментов мы, в основном, были заняты измерениями — температуры воды в чаше, температуры подогреваемого продукта и времени процесса.

    Подогрев молока в бутылочке

    100 мл обычного коровьего молока температурой 8,1 °C налили в детскую бутылочку. Залили в чашу подогревателя 110 мл воды, поместили туда бутылочку и включили режим подогрева до 40 °C.

    Нагреватель работал беспрерывно 30 секунд, затем индикатор погас. У нас не было ни малейшего сомнения в том, что ни вода, ни, тем более, молоко в бутылочке не достигли необходимой температуры. Поэтому продолжили ожидание.

    Спустя 5 минут нагрева температура молока в бутылочке достигла 26 °C. Через 10 минут — 30,6 °C. За 15 минут работы прибора вода в нем нагрелась до 37,5 °C, молоко — до 34,1 °C. За 15 минут нагреватель в общей сложности работал 1 мин 48 сек. Энергопотребление составило 0,005 кВт·ч.

    Результат: хорошо

    Не очень быстро, зато бережно и безопасно. Результаты наших экспериментов подтвердили рекомендации инструкции о нагреве 90 мл молока в течение 10 минут.

    Подогрев детского пюре в стеклянной баночке

    Детское пюре в стеклянной баночке хранилось в кухонном шкафу, т. е. перед началом эксперимента имело комнатную температуру. Вес — 80 г. Залили в подогреватель 100 мл воды и перевели термостат на режим разогрева до 70 °C.

    Далее измеряли температуру воды в подогревателе и пюре в баночке через определенные промежутки времени:

    Время нагрева Температура воды Температура пюре в баночке
    5 минут 56,5 °C 36,5 °C
    10 минут 61,5 °C 49,3 °C

    Очевидно, что далее прибор будет работать в режиме поддержания, а температура пюре в баночке будет стремиться к выравниванию с температурой воды в подогревателе. За 10 минут нагреватель работал 5 мин 11 сек, прибор потребил 0,011 кВт·ч.

    При разогреве питания в комплектном стакане подготовка проста: залить 100 мл воды в прибор, выложить детское питание в стаканчик, установить стаканчик в подогреватель. Для равномерного разогрева содержимое нужно периодически перемешивать. 100 г овощного пюре комнатной температуры за пять минут в режиме 70 °C достигли 34,8 °C. Непосредственно нагреватель работал 4 мин 9 сек, энергопотребление составило 0,008 кВт·ч.

    Результат: хорошо

    Особенно удобно подогревать небольшие объемы детского питания. При этом можно греть хоть в баночке, хоть в комплектном стакане. Главное, что температура готового пюре никогда не превысит режимной, а значит, риск перегрева исключен.

    Стерилизация

    Для стерилизации двух сосок потребовалось налить в прибор 220 мл воды. Именно этот объем воды полностью покрыл аксессуары.

    Установили режим стерилизации. Нагревательный элемент работал непрерывно. Вода закипела лишь на 16 минутах 30 секундах. Вода кипела, но не выплескивалась за края прибора. Кипятили соски около двух минут. Итого за 19 минут работы подогреватель потребил 0,035 кВт·ч.

    На наш взгляд, функция стерилизации в подогревателе Kitfort KT-2301 носит скорее декоративный, чем практический характер, поскольку цикл длителен по времени, а объем чаши подходит лишь для одной, максимум двух, сосок.

    Результат: удовлетворительно.

    Выводы

    Kitfort KT-2301 ценен, прежде всего, своим размером. Подогреватель способен подогреть молоко или детскую смесь в бутылочке размером не более 15 см в высоту. Комплектный стаканчик предназначен для разогрева не более 170 мл детского питания. Симпатичный внешний вид, безопасность и простоту управления также отнесем к плюсам изделия. Режим поддержания температуры поможет сохранить смесь, нагретую до определенной температуры, в течение некоторого времени.

    Однако подогревает даже минимальное количество детского питания прибор относительно долго. Поэтому к нему нужно будет привыкнуть и приступать к подготовке к кормлению, как минимум, минут за 15. Зато медленный процесс обеспечивает бережный нагрев с постепенным повышением температуры. Использование прибора в качестве стерилизатора, на наш взгляд, дополнительная, а не основная, функция. Из-за компактности возможна стерилизация лишь одной или двух сосок или пустышек. Продолжается же процесс около 20 минут.

    Плюсы

    • компактный размер
    • простота управления и эксплуатации
    • режим поддержания температуры
    • возможность стерилизовать мелкие аксессуары — соски и пустышки
    • низкая цена

    Минусы

    • долгий цикл работы
    • температура подогретой смеси слегка ниже установленных температур

    Kitfort KT-2302

    Модель отличается от рассмотренной выше не только размером и ценой, но и дополнительными параметрами управления — световой и звуковой сигнализацией.

    Во время тестирования мы сосредоточимся на измерениях температуры и времени достижения установленного уровня нагрева, а также оценке удобства и безопасности эксплуатации.

    Характеристики
    Производитель Kitfort
    Модель KT-2302
    Тип подогреватель для бутылочек
    Страна производства Китай
    Гарантия 1 год
    Предполагаемый срок службы 2 года
    Мощность 250 Вт
    Режимы работы три: 40 °C, 70 °C, 100 °C
    Индикатор нагрева
    Тип нагревателя РТС (позистор)
    Теплоноситель вода
    Вместимость две бутылочки для детского питания объемом до 0,4 л
    Аксессуары держатель бутылочек
    Особенности автоматический режим поддержания температуры, функция автоотключения
    Вес 0,79 кг
    Габариты (Ш×В×Г) 20×34×16 см
    Длина сетевого кабеля 95 см
    Вес с упаковкой 0,98 кг
    Габариты упаковки (Ш×В×Г) 19,5×24×14 см
    Средняя цена
    Розничные предложения
    Комплектация

    Размер картонной коробки, в которую уложен подогреватель, чуть крупнее, чем у предыдущей модели. Информация, размещенная на упаковке, все та же: изображение прибора, перечень его особенностей и технических характеристик. Внимательное изучение сведений поможет составить первое впечатление об аппарате. Вообще все приборы из так называемого детского ассортимента Kitfort оформлены абсолютно одинаково: один цвет и один стиль, а вместо стилизованных брызг воды над логотипом — улыбающимся китом — облако а-ля детских рисунков: человечка, домика, грибочка, листика и прочего. Мило и ненавязчиво.

    Вскрыв коробку, внутри мы обнаружили: сам прибор и несколько документов. Инструкция по эксплуатации, гарантийный талон и рекламные листовки были уложены в один полиэтиленовый пакет. Прибор со всеми аккуратно уложенными деталями и аксессуарами защищен от царапин и внешних повреждений полиэтиленовым пакетом. Подогреватель в разобранном виде состоит из:

    • корпуса с нагревательным элементом и чашей,
    • корзины,
    • держателя бутылочек,
    • крышки.
    На первый взгляд

    Прибор изготовлен все в том же молочно-белом цвете. Дно и область вокруг термостата имеют нежный пастельно-голубой цвет. Аксессуары изготовлены из темного пластика. С лицевой стороны корпуса расположен термостат. Аппарат малогабаритный, так что не займет на кухонном столе много места. Корпус расширяется к основанию. На столе подогреватель располагается устойчиво и надежно, не скользит.

    Внутренняя сторона корпуса представляет собой емкость, под которой расположен нагреватель. Однако нагревательный элемент мы увидеть не можем, поскольку он защищен пластиковым дном чаши. На дне расположены отверстия, сквозь которые вода попадает на нагреватель.

    В чашу устанавливается решетчатая корзина с отверстиями и на дне, и на стенках. Благодаря такой форме вода может свободно циркулировать по всему объему чаши. На боковых сторонах корзины имеются небольшие ручки, помогающие извлечь аксессуар. На стенках корзины расположены упоры, на которых размещается держатель бутылочек.

    Держатель бутылочек представляет собой решетку овальной формы. Предназначен для стерилизации бутылочек, аксессуаров и другой подходящей тары для детского питания. Два круглых отверстия по центру нужны для быстрого комфортного извлечения держателя из корзины — вставляешь пальцы и достаешь или устанавливаешь деталь.

    Сверху размещается крышка, изготовленная из прозрачного пластика. Она оснащена удобной ручкой, которая позволяет открывать и закрывать чашу, не касаясь поверхности крышки. Это снижает опасность получения ожога при использовании прибора в качестве стерилизатора.

    В нижней части основания с задней стороны выходит шнур электропитания. Отсеком для хранения шнура прибор не оснащен. Длина шнура представляется нам достаточной для использования в обычных условиях.

    Со стороны дна можно увидеть четыре небольшие ножки с прорезиненными накладками для предотвращения скольжения по поверхности стола, а также вентиляционные отверстия и наклейку с краткой информацией об изделии.

    Пластик, из которого изготовлен сам прибор и его аксессуары, выглядит качественным, хорошо обработанным, он гладкий на ощупь и не издает никакого запаха.

    Инструкция

    Инструкция формата А5 напечатана на плотной глянцевой бумаге. Содержание ее стандартно и охватывает все аспекты эксплуатации, а также знакомит с устройством и наименованием отдельных частей подогревателя и мерами безопасности при его использовании.

    Основной и наиболее важный для пользователя раздел эксплуатации содержит три пошаговых описания использования прибора — в качестве подогревателя до 40 °C детского питания в бутылочках, до 70 °C для разогрева детской еды и в качестве стерилизатора. Каждый из алгоритмов сопровожден советами. Для безопасной эксплуатации, по нашему мнению, достаточно однократного изучения документа.

    Управление

    Как и KT-2301, управляется подогреватель перемещением термостата на необходимую пользователю позицию. Однако у Kitfort KT-2302 сам переключатель выполнен в форме круглого регулятора. Его удобнее вращать. Ход пошаговый, пропустить нужный режим просто невозможно. Режимы работы стандартны для этого типа устройств: подогрев молочной смеси до 40 °C, разогрев детского питания до 70 °C, стерилизация на 100 °C.

    После включения в сеть прибор издает длительный однократный звуковой сигнал, а индикатор вокруг термостата начинает подсвечиваться оранжевым цветом. При переводе термостата в рабочее положение, индикатор изменяет свой цвет на зеленый. Зеленый цвет горит во время подогрева и в режиме поддержания температуры.

    Прибор автоматически отключается через 8 часов при работе в режиме подогрева на 40 °C, через 3 часа на 70 °C. При стерилизации нагрев прекращается примерно через 15 минут, еще через пять минут срабатывает функция автоотключения. При отключении раздается звуковой сигнал.

    Так что все просто и, что немаловажно при эксплуатации такого типа устройств, безопасно.

    Эксплуатация

    Порядок действий при подготовке прибора к эксплуатации полностью идентичен вышеописанному для Kitfort KT-2301. Напомним, что инструкция рекомендует довести воду в чаше подогревателя до кипения. После чего выключить прибор, слить воду и повторить операцию еще 4-5 раз. Детей нам не кормить, поэтому мы ограничились перед первым использованием одним циклом кипячения и слива воды. Сделали мы это, чтобы проверить, помутнеет ли вода или нет. Вода не помутнела. Никаких посторонних запахов от прибора при первом включении мы также не почувствовали.

    Эксплуатация несложна. В чашу следует залить около 450 мл воды, поместить туда же корзину, бутылочки или баночки с детским питанием, закрыть подогреватель крышкой, выставить необходимый температурный режим и на некоторое время отойти. Прибор сначала будет греть воду до заданной температуры, затем перейдет в режим поддержания. В режиме поддержания температуры аппарат периодически включается, удерживая температуру воды на одном уровне. По окончании следует перевести термостат в положение Off, отключить подогреватель от сети и слить воду из чаши. Время подогрева 90 мл молока составляет около 10 минут.

    Несколько советов позволят достигнуть оптимальных результатов:

    • уровень воды в чаше должен быть равен или чуть больше уровня жидкости в бутылочке или детского пюре в баночке
    • вода в чаше не должна превышать максимального уровня: 1 см от верхнего края
    • во избежание порчи нельзя длительное время держать детское питание в режиме поддержания температуры
    • при искусственном вскармливании в подогревателе рекомендовано держать бутылочку с водой, а смесь добавлять непосредственно перед кормлением
    • для равномерного нагрева детского питания его следует периодически перемешивать
    • перед следующим циклом нагрева подогревателю следует дать остыть в течение нескольких минут

    Стерилизация с помощью Kitfort KT-2302 проста и безопасна. В чашу следует залить около 50 мл воды. Установить корзину, а в нее — держатель для бутылочек. Кверху дном уложить на держатель стерилизуемые аксессуары и закрыть подогреватель крышкой. Перевести термостат в режим стерилизации на 100 °C. По истечении 15 минут цикл автоматически прервется, индикатор загорится красным цветом. Еще через пять минут прибор отключится.

    Объем прибора вполне пригоден как для помощи в кормлении новорожденных, так и при подогреве детского питания уже подросшим младенцам. При стерилизации в чашу свободно устанавливается большая детская бутылочка объемом в 260 мл, соска, пустышка и другие аксессуары.

    Уход

    После каждого использования следует сливать воду из чаши подогревателя. Внешнюю и внутреннюю части прибора необходимо протереть влажной тканью. Аксессуары — держатель бутылочек, корзину и крышку можно мыть теплой водой с мягким моющим средством. Запрещено помещать корпус подогревателя в воду, а также использовать для очистки агрессивные, абразивные и антибактериальные чистящие средства.

    Раз в месяц инструкция рекомендует очищать подогреватель от накипи. Для этого нужно смешать 100 мл столового уксуса и 300 мл холодной воды, залить смесь в чашу. Вместо уксуса можно использовать средства для удаления накипи на основе лимонной кислоты. Затем аппарат в течение 10 минут работает в режиме нагрева до 40 °C. После чего рекомендуется выключить прибор и оставить смесь в чаше до полного растворения известкового налета. Лучше бы, конечно, Kitfort указал конкретный промежуток времени, потому что увидеть, растворился ли весь налет или нет, мы никак не можем. Завершается очистка от накипи сливом раствора и тщательной промывкой чаши подогревателя.

    Тестирование

    Наши измерения

    Мощность прибора при работе нагревателя колеблется между 262 и 275 Вт, что немного превышает заявленную производителем мощность. Работает прибор беззвучно.

    100 мл воды из-под крана закипают за 4 минуты.

    Практические тесты

    Сосредоточимся на том, насколько прибор удобен в эксплуатации, соответствуют ли заявленные температуры реальным показателям и сколько времени требуется для нагрева определенных объемов детского питания.

    Стерилизация

    Начали мы со стерилизации. Залили в чашу 50 мл воды. Установили полой частью вниз на держатель бутылочку в 260 мл, ее аксессуары и одну пустышку.

    Примерно через пару минут вода закипела. Спустя 13 мин 7 сек с начала операции прибор издал три звуковых сигнала, индикатор загорелся оранжевым цветом, что свидетельствовало об окончании работы нагревателя. Спустя еще пять минут прибор отключился, индикатор перестал гореть.

    За цикл стерилизации прибор потребил 0,058 кВт·ч.

    Результат: отлично

    Нас порадовал как объем подогревателя, пригодный для стерилизации бутылочек и других приспособлений для детского питания, так и функция автоматического отключения.

    Подогрев молока в бутылочке

    Установили на дно держатель для бутылочек, залили в чашу 450 мл воды. Поставили внутрь одну бутылочку со 100 мл коровьего молока температурой 8 °C. Задали режим подогрева до 40 °C. Периодически проводили измерения температуры воды в чаше и молока в бутылочке. Полученные данные свели в таблицу:

    Время с начала нагрева Температура воды в чаше Температура молока в бутылочке Время работы нагревательного элемента
    5 минут 35,1 °C 24,9 °C 2 мин 21 сек
    10 минут 37 °C 31,8 °C 2 мин 31 сек
    15 минут 42,3 °C 38,2 °C 3 мин 29 сек

    Как видим, рекомендации инструкции о продолжительности нагрева 90 мл молока в течение 10 минут правдоподобны. За 10 минут нагрева температура воды приближается к установленной. За 15 минут работы подогреватель израсходовал 0,019 кВт·ч.

    Результат: хорошо

    Так же, как и в Kitfort KT-2301: не очень быстро, зато безопасно и удобно.

    Разогрев детского питания

    80 г детского питания в стеклянной баночке имели комнатную температуру. В чашу нагревателя было залито 400 мл воды так, чтобы вода находилась чуть ниже уровня крышки баночки с пюре.

    Передвинули термостат на указатель в 70 °C и начали наблюдения.

    Время с начала нагрева Температура воды в чаше Температура пюре в баночке Время работы нагревательного элемента
    5 минут 53,5 °C 40 °C 5 мин 00 сек
    10 минут 68,3 °C 57,8 °C 7 мин 33 сек

    Непрерывный нагрев приостановился на 6 мин 48 сек. Температура воды при этом достигла 66,2 °C. Значит, в режим поддержания температуры прибор переходит на седьмой минуте работы. Нагреватель при этом периодически включается, температура приближается, но не превышает 70 °C. За 10 минут работы в режиме разогрева энергопотребление составило 0,035 кВт·ч.

    При дальнейшем нахождении в чаше пюре продолжало разогреваться, постепенно достигая температуры воды. Так что не следует пренебрегать рекомендацией всегда пробовать детское питание, чтобы оно не было слишком горячим.

    Результат: отлично

    Выводы

    Kitfort KT-2302 прекрасно справляется со всеми заявленными функциями: подогревает молоко, разогревает детское питание, стерилизует бутылочки и прочие аксессуары для детского питания. При этом функция стерилизации реализована настолько хорошо (достаточный объем чаши и автоотключение), что при определенных условиях отпадает потребность в приобретении отдельного стерилизатора. Прибор симпатично выглядит и не занимает много места.

    Одновременно в нем могут быть размещены две бутылочки для детского питания, а значит, он подойдет для родителей подросших малышей или близнецов. К минусам можно отнести отсутствие отсека для хранения шнура. Так что родителям следует внимательно следить за тем, чтобы кабель электропитания ни в коем случае не свисал с края стола, особенно в том случае, если ребенок начал ползать.

    Плюсы

    • объем чаши
    • простота управления и эксплуатации
    • звуковые сигналы
    • качественная стерилизация
    • режим поддержания заданной температуры и автоотключения

    Минусы

    • отсутствие отсека для хранения шнура

    Общие выводы

    Помимо предназначения, обе модели подогревателей имеют общие черты. Приборы изготовлены из безопасных материалов, качество исполнения оценено как высокое, аппараты безопасны и просты в эксплуатации. Управление и уход не вызывают никаких затруднений. Оба подогревателя оснащены тремя режимами работы: 40 °C, 70 °C и 100 °C. В обоих устройствах осуществляется бережный и медленный подогрев молока и длительное поддержание температуры. Способ нагрева также одинаков — за счет внешнего теплоносителя. Схожи подогреватели и продолжительностью подогрева — 90 мл молока греются до нужной температуры около 10 минут.

    Kitfort KT-2301 отличается, прежде всего, своим компактным размером и связанными с этим ограничениями — подогреть можно лишь одну бутылочку высотой не более 15 см, а стерилизовать лишь одну-две соски или пустышки. Прибор оснащен отсеком для хранения шнура.

    Kitfort KT-2302 мощнее и крупнее по габаритам. Поэтому в нем можно одновременно подогревать две бутылочки объемом до 0,4 л, а также стерилизовать полный комплект для детского питания (бутылочку и ее аксессуары). Процесс стерилизации автоматически отключается приблизительно по истечении 15 минут. Также прибор оснащен режимами автоотключения после 8 часов работы на 40 °C и через 3 часа на 70 °C. Устройство оснащено звуковыми сигналами. Световой индикатор функционирует значительно лучше и воспринимается пользователем легче, чем у KT-2301. Т. е. прибор можно считать более продвинутым, чем KT-2301.

    На наш взгляд, если существует длительная стабильная потребность в подогреве (например, ребенок на искусственном вскармливании), то модель Kitfort KT-2302 более предпочтительна. Если же подогрев требуется лишь периодически (например, на время отсутствия кормящей матери), или у пользователя нет потребности в дополнительной функции стерилизации, или вообще непонятно, нужен такой прибор или нет, то Kitfort KT-2301 будет вполне уместен.

    Оба прибора отлично подходят как подарки, особенно в условиях ограниченного бюджета — стоят недорого, места занимают мало и действительно могут пригодиться.

    10 лучших подогревателей бутылочек: рейтинг подогревателей [ТОП 10]

    При грудном вскармливании необходимости в подогреве молока не существует. Однако когда мама малыша кормит его искусственной смесью, то ей следует позаботиться о приобретении специального оборудования – подогревателя для питания и молока. При помощи этого устройства еда ребенка будет прогреваться до комфортной температуры, причем она будет поддерживаться в течение длительного времени. Сегодня в детских специализированных магазинах существует достаточно большой выбор подобных изделий, которые могут сильно отличаться друг от друга по принципу работы и многим другим параметрах. В таком многообразии запутаться достаточно просто, поэтому наш сегодняшний рейтинг мы решили посвятить обзору лучших подогревателей для бутылочек. Однако перед тем, как приступить к непосредственному анализу характеристик, давайте разберемся, что представляет собой такое оборудование и на что следует обращать внимание при покупке этой продукции.

    Какие параметры важны при выборе подогревателя для бутылочек?

    Устроено подобное изделие довольно просто: оно включает в себя электроизолированную емкость, специальный нагревательный элемент, реле, при помощи которого производится управление, а также питающий кабель. Принцип работы во многом похож на водяную баню: специальный контейнер заполняется водой, которая подогревается и передает свое тепло жидкости, находящейся в бутылочке.

    Размер контейнера может быть универсальным, благодаря чему туда поместятся бутылочки даже нестандартных форм и величины. Однако в продаже можно встретить устройства, рассчитанные на определенный бренд – в этом случае бутылочки и подогреватель должны быть от одного производителя. Питание может осуществляться от стандартной электросети – такие изделия лучше всего подходят для стационарного использования. Подогреватель может работать от батареек или аккумулятора: такое устройство удобно применять при регулярных разъездах, а также при переносе с одного места на другое. Автомобильный вариант подогревателя функционирует непосредственно от прикуривателя. Встречаются и универсальные модели, которые работают от всех источников.

    Нагреваться детское питание может по-разному: теплой водой, горячей водой или паром. В первом случае подогрев производится водой, температура которой достигает порядка 50 градусов. Перегреть смесь в таком изделии невозможно, соответственно ни родители, ни ребенок не смогут обжечься. Однако процесс подогрева здесь занимает достаточно много времени. Горячая вода позволяет сократить время нагрева, однако при использовании такого оборудования следует быть максимально осторожным, прежде всего, родителям, так как вероятность обжечься значительно выше.

    Паровые подогреватели для бутылочек согревают питание в течение считанных секунд – для этого применяется небольшое количество горячего пара. Бутылочку следует извлекать оттуда максимально аккуратно. Стоит отметить, что использовать данный подогреватель для размораживания молока не рекомендуется.

    Желательно, чтобы у подобного изделия были дополнительные функции, например, регулировка температуры смеси, таймер и так далее. Все они окажутся весьма полезными в случае, если в бутылочках будут разогреваться продукты различной плотности. В продаже также можно встретить изделия с возможностью программирования, которые будут подогревать детскую пищу к определенному времени. Наиболее продвинутые модели оснащаются стерилизатором посуды или же паровым центром, который можно применять в качестве пароварки для приготовления на пару различных овощей, фруктов и так далее.

    Приобретать такую продукцию необходимо исключительно в аптеках либо в специализированных детских магазинах. Не лишним будет ознакомиться с сертификатом качества, узнать как можно больше о компании-изготовителе, безопасности с экологической точки зрения, о материалах, из которых выполнена данная конструкция. Обращают внимание и на комплектацию подогревателя. В идеале, вместе с устройством должен идти термос.

    При составлении рейтинга лучших подогревателей для бутылочек 2020 года мы учли все эти факторы, но при выборе опирались, главным образом, на отзывы пользователей и соотношение цены и качества конструкции. По каждой модели мы постарались собрать максимум информации, надеемся, что после изучения нашего рейтинга вы сможете подобрать для себя и своего малыша наиболее оптимальную конструкцию.

    Модели для автомобилей

    4. Maman LS-C001

    Превосходно подходит для достаточно длительных поездок. Устройство компактное и универсальное – в его емкость с легкостью поместятся даже достаточно габаритные бутылочки. В комплекте с устройством идет очень удобный чехол, превосходно сохраняющий комфортную температуру детского питания в течение достаточно долгого времени. На чехле есть петли на липучках – при необходимости изделие можно будет повесить. Адаптер, питающий устройство через прикуриватель, можно убрать в специальный кармашек. Никаких дополнительных кнопок не предусмотрено: достаточно вставить адаптер, после чего изделие приступает к подогреву. Это занимает приличное количество времени – порядка 40 минут, однако в дальней дороге это не кажется слишком критичным.

    Имеется встроенный электронный термостат, который не позволяет питанию перегреваться в процессе нагрева. Максимальный объем бутылочки, которая может туда поместиться, составляет 300 мл. Наибольшая температура, до которой нагревается еда, составляет 65 градусов. Изделие не нуждается в использовании воды. Оно прекрасно справляется с возложенными на него функциями.

    Преимущества:

    • Компактные габаритные размеры;
    • Продолжительный срок службы;
    • Высокое качество изготовления и сборки;
    • Предусмотрен термостат.

    Недостатки:

    • Еда разогревается довольно долгое время.

    Maman LS-C001

    3. Medela B.Well WK-131

    Этот обогреватель позволяет обеспечить ребенка теплым и горячим питанием во время долгой дороги. Устройство функционирует от автомобильного адаптера, не нуждается в использовании воды. В его емкости можно разогревать готовые молочные смеси, натуральное грудное молоко и прочие продукты для ребенка до приемлемой температуры, которая будет не слишком горячей и не слишком холодной. Максимальный нагрев достигает 40 градусов, а за счет дополнительной функции термоса продукты могут долгое время оставаться охлажденными. Устройство изготовлено в виде небольшой сумочки, которая не нуждается в большом количестве свободного пространства и удобна в процессе транспортировки. Внутренняя часть изделия производится из теплоизолирующих материалов, благодаря чему температура будет сохраняться довольно комфортной в течение трех часов.

    Работает от стандартного прикуривателя с напряжением 12 В, мощность устройства составляет порядка 18 Вт. Есть сетевой индикатор, который покажет – включен прибор или нет. Времени на подогрев уходит не слишком много – около 20 минут. Устройство вместе со всеми принадлежностями весит всего лишь 300 граммов при габаритных размерах 90х85х245 мм. Его разрешается использовать при температуре от +10 до +40 градусов, влажность воздуха не должна превышать 90%.

    Преимущества:

    • Может использоваться для подогрева как смесей, так и питания;
    • Хорошо подходит для бутылочек различной формы и объема;
    • Бутылочка удобна в применении.

    Недостатки:

    • Отсутствует термостат, срабатывающий при перегреве;
    • Можно использовать только в автомобиле.

    Medela B. Well WK-131

    2. CS Medica KIDS CS-21

    Эта конструкция позволяет быстро разогреть питание для ребенка, причем нагрев осуществляется максимально равномерно до комфортной температуры, поэтому в пище будут сохраняться все полезные для малыша витамины и минералы, которые очень важны для правильного развития организма. Резервуар для бутылочки имеет универсальную форму, поэтому в нем удастся разместить даже достаточно широкую продукцию. Модель оборудована специальным звуковым сигналом, который будет оповещать пользователя о завершении процесса подогрева. Изделие способно функционировать от бортовой электросети автомобиля, нет необходимости использовать воду.

    Данное устройство станет хорошим помощником в долгих путешествиях вместе с маленьким ребенком. В комплекте с изделием поставляется термосумка, изготовленная из современных материалов, способных долгое время удерживать тепло или прохладу. Срок, в течение которого питание будет сохранять приемлемую для использования температуру, составляет порядка 3 часов. В резервуаре разрешается подогревать даже стеклянные баночки с питанием, однако они обязательно должны быть открыты. Изделие не нуждается в специальном уходе – вполне достаточно протирать и очищать как нагревательный элемент, так и внутреннюю и внешнюю поверхности мягкой, слегка увлажненной тканью.

    Преимущества:

    • Питание разогревается равномерно;
    • Чехол долгое время способен сохранять необходимую температуру;
    • Безопасность использования;
    • Высокое качество изготовления;
    • Ухаживать за изделием довольно легко.

    Недостатки:

    • Относительно дорогое устройство.

    CS Medica KIDS CS-21

    1. Сhicco Travel

    Это универсальный подогреватель, который можно использовать как в домашних условиях, так и в поездках. В комплекте идут два питающих кабеля – один для подключения к бытовой электросети, второй для работы от сети автомобиля. Также имеется и держатель для баночек и бутылочек, который изготавливается из пластика очень высокого качества с хорошими термоизоляционными характеристиками, что будет защищать руки пользователя от паровых ожогов. Внутрь подогревателя заливается небольшое количество воды, ей будет передаваться тепло от нагревательного элемента. Перед включением следует отыскать ровную поверхность, воду заливают при помощи специального мерного стаканчика. Она прогревается до необходимой температуры в течение нескольких минут.

    Для включения прибора достаточно нажать большую круглую кнопку. Стоит отметить, что данное устройство цифровое – на поверхности корпуса имеется большое количество разного рода индикаторов. После включения дисплей со всеми обозначениями загорается синим цветом, причем довольно ярким. По умолчанию по всем параметрам выставлены ноли. На панели управления есть три механические кнопки. Верхняя позволяет выбрать тип емкости для нагрева и ее объем (бутылочка со смесью или баночка с питанием, объемы могут колебаться от 150 до 400 мл). Средняя кнопка отвечает за выбор температуры питания. Нижняя помогает выбрать время работы устройства, причем даже после достижения выбранной температуры, подогреватель все равно будет продолжать работать, поддерживая данный показатель. Максимальное время подогрева составляет 30 минут.

    Преимущества:

    • Быстро и равномерно прогревает пищу;
    • Сохраняет в еде все питательные вещества;
    • Универсальная модель;
    • Легко пользоваться.

    Недостатки:

    • В машине разогревает дольше;
    • Белый цвет в поездках может быстро загрязниться.

    Сhicco Travel

    Подогреватели с функцией стерилизации

    4. Kitfort KT-2302

    Превосходно справляется со всеми возложенными на него функциями. Прибор состоит из следующих элементов: держатель, корпус, оснащенный нагревательным элементом и чашей, корзинка и крышка. На поверхности корпуса можно найти термостат, который позволяет выставить необходимую температуру в пределах от 40 до 100 градусов. Аксессуары выполнены из темного и немаркого пластика. Подогреватель занимает минимум свободного пространства в помещении. Корпус к основанию расширяется, что придает изделию дополнительную устойчивость, а прорезиненные ножки защищают от скольжения по поверхности.

    Нагревательный элемент скрыт под пластиковым дном, на котором есть ряд отверстий, через которые к нему будет поступать вода. У корзины есть отверстия по бокам и на дне, благодаря чему весь объем воды будет хорошо циркулировать по всему ее объему. Кроме того, она оборудована небольшими ручками, способными удобно защитить руки от ожогов. Держатель бутылочек выполнен в форме решетки – эта деталь необходима для стерилизации посуды. Крышка выполнена из прозрачного пластика с удобной ручкой. Рабочая температура выставляется при помощи обыкновенного поворотного регулятора пошагового типа, поэтому пропустить нужный режим работы попросту невозможно. Производитель рекомендует для продления срока службы после каждого применения сливать воду из чаши и протирать все детали мягкой влажной тканью.

    Преимущества:

    • Хорошее качество изготовления;
    • Простота и удобство в использовании;
    • Приемлемая стоимость;
    • Занимает минимум свободного пространства;
    • Продолжительный период эксплуатации.

    Недостатки:

    • Не очень удобная ручка переключения температурных режимов;
    • Емкость для бутылочек можно было бы сделать и побольше.

    Kitfort KT-2302

    3. Miniland Warmy Plus

    Еще одно универсальное устройство в нашем рейтинге лучших подогревателей для бутылочек. В комплекте с изделием идет вкладка для бутылочек, вкладка для баночек с пюре, а также переходник для использования через бортовую автомобильную сеть. Как стерилизатор не слишком удобен – не очень большая вместимость, однако он может использоваться для стерилизации пустышек и прочих мелких деталей. Хорошо подойдет для стерилизации бутылочек в дальней дороге. Разогревается пища достаточно быстро – на это уходит всего лишь порядка 3-5 минут. Однако есть некоторые расхождения с указаниями производителя: далеко не всегда указанного количества воды достаточно для того, чтобы тщательно прогреть определенный объем питания, поэтому этот параметр придется определять самостоятельно. Размер резервуара таков, что в него поместятся бутылочки разных форм и размеров.

    Габаритные размеры изделия достаточно компактные, подогреватель не займет много места как в доме, так и в автомобиле, что делает его весьма подходящим для продолжительных путешествий. На поверхности корпуса имеется световая индикация, также предусмотрено звуковое оповещение, однако отключить его не представляется возможным, поэтому ночью пользоваться таким устройством следует максимально осторожно. Максимальный объем бутылочек, которые могут поместиться в резервуар, составляет 360 мл – вполне достаточно, чтобы полноценно накормить ребенка.

    Преимущества:

    • Предусмотрен переходник для использования в автомобиле;
    • Есть световое и звуковое оповещение о готовности;
    • Быстро разогревает питание.

    Недостатки:

    • Потребляет довольно много электроэнергии.

    Miniland Warmy Plus

    2. Dr. Brown’s 851

    Отличается компактными габаритными размерами, поэтому на кухне или в комнате займет не слишком много места. К сожалению, питающий кабель довольно короткий, поэтому необходимо размещать в непосредственной близости к розетке или же использовать удлинитель. Емкость для бутылочки оснащена очень удобной пластиковой крышкой, которая не будет сильно нагреваться в процессе работы устройства. В комплекте с изделием поставляется специальный стакан с решетчатыми отверстиями, куда и будет устанавливаться бутылочка. Стоит отметить, что дно у стакана съемное и может регулироваться по высоте, что делает устройство оптимальным для подогрева баночек с детским питанием.

    К сожалению, данное изделие оптимально подходит только для продукции компании Brown’s. Бутылочки других производителей могут в нем вообще не поместиться, особенно, если они довольно широкие и приземистые. Для слишком высоких бутылочек стакан тоже не подойдет, так как они будут попросту выдаваться за пределы резервуара. Заливать воду в резервуар весьма удобно – емкость с водой располагается сбоку: всегда будет видно, когда она заканчивается, а также не придется лишний раз заглядывать в емкость с бутылочкой.  Электронный дисплей оборудован подсветкой, которую очень хорошо видно в полной темноте, он показывает время, оставшееся до завершения работы. Предусмотрена защита от перегрева, звуковая сигнализация.

    Преимущества:

    • Высокий уровень практичности изделия;
    • Подогрев осуществляется очень бережно;
    • В питании сохраняется все необходимое для нормального развития ребенка;
    • Разогревается пища при помощи пара.

    Недостатки:

    • Подходит далеко не для всех бутылочек;
    • Довольно дорогое устройство.

    Dr. Brown’s 851

    1. Beaba Bib’expresso

    Отличается достаточно быстрой работой вне зависимости от выбранной функции – подогрев пищи, стерилизация посуды или ее просушивание. Питание разогревается до необходимой температуры в течение всего лишь 30-35 секунд. Это позволяет моментально среагировать на голодного ребенка и приступить к его кормлению, что наиболее важно в ночные часы. С помощью данной модели можно даже приготовить смесь, в которой не будут содержаться комочки. Подогреватель оборудован съемной водяной баней, она является универсальной, хорошо подойдет как для бутылочек, так и для баночек с пюре, причем в бутылочках может содержаться и искусственная смесь, и сцеженное материнское молоко. В комплекте с устройством поставляется контейнер для хранения трех бутылочек или баночек, максимальный объем которых может составлять 300 мл.

    Резервуар очищается самостоятельно благодаря встроенной паровой системе, есть очень удобный рычаг подачи воды. Габаритные размеры не очень большие – 26х23х36 см, производится подогреватель исключительно из безопасных для здоровья материалов. Масса изделия составляет порядка 1,2 кг. Корпус изготовлен из качественного пластика, все его элементы надежно подогнаны друг к другу, даже в процессе длительной эксплуатации не возникает посторонних звуков типа скрипов.

    Преимущества:

    • Очень быстро подогревает воду до 37 градусов;
    • Простой в использовании;
    • Небольшие габаритные размеры;
    • Есть функция самоочистки.

    Недостатки:

    Beaba Bib’expresso

    Подогреватели-термосы

    2. Avent Philips SCF256/00

    В плане бутылочек является универсальным устройством, так как в него помещаются абсолютно любая продукция за исключением, разве что, поильника с рукоятками. Верхняя крышка накручивается на стакан достаточно плотно, поэтому никаких подозрений на протечки даже после длительного использования не возникает. Это очень важно, так как подобное устройство в большинстве своем применяется в дорожных условиях, а используемый в процессе работы изделия кипяток может привести к серьезным ожогам. Непосредственно сам термос изготавливается из металла, обладает толстыми стенками, стеклянной колбы не предусмотрено, что делает устройство более долговечным и безопасным в плане эксплуатации. Крышка имеет кнопку для открывания, что позволяет дольше сохранять приемлемую температуру питания.

    Под резинкой помповой крышки могут постепенно начинать скапливаться различные загрязнения, избавиться от которых не слишком сложно. Стакан для горячей воды, куда будет устанавливаться бутылочка, изготовлен из качественного пластика, хорошо выдерживающего воздействие как высоких, так и низких температур. На нем выгравированы данные, касающиеся соотношения времени подогрева и объема разогреваемой жидкости. Горловина термоса достаточно узкая, поэтому его можно использовать и взрослым людям в путешествиях и походах. Металлическая поверхность немного маркая – на ней будут хорошо заметны отпечатки пальцев и прочие загрязнения.

    Преимущества:

    • Абсолютно безопасный;
    • Быстро разогревает;
    • Компактные габаритные размеры;
    • Есть надежная защита от детей;
    • Привлекательный внешний вид;
    • Простота в использовании.

    Недостатки:

    • Довольно дорого стоит.

    Avent Philips SCF256/00

    1. Tommee Tippee 42300041

    Компактное, очень удобное и универсальное устройство не зря оказалось на первом месте в своем сегменте рейтинга лучших подогревателей для бутылочек. Его допустимо использовать как в качестве подогревателя, так и термоса. Конструкция отличается толстыми металлическими стенками, которые позволяют в течение двух часов сохранять приемлемую температуру детского питания даже в случае, если на улице довольно холодно. В комплекте поставляется также контейнер для разогревания еды. Он выполнен из высококачественного пластика, который отличается превосходными гипоаллергенными характеристиками.

    Как отмечают пользователи, габаритные размеры изделия невелики, поэтому в дороге оно будет весьма удобно. К тому же в него с легкостью поместятся бутылочки самых разных размеров. Может использоваться как для искусственной смеси, так и для натурального материнского молока.

    Преимущества:

    • Долгое время сохраняет температуру;
    • Весит не слишком много;
    • Корпус обладает хорошими ударопрочными качествами;
    • В комплекте имеется контейнер для бутылочек.

    Недостатки:

    • Помимо высокой цены, пользователи отмечают, что здесь разогревать можно только бутылочки.

    Tommee Tippee 42300041

    В заключении полезное видео

    Ну вот и завершился наш обзор лучших подогревателей для бутылочек 2020 года. Надеемся, что вам оказалось вполне достаточно информации для того, чтобы определиться с подходящей моделью. Если же у вас остались некоторые вопросы или же вы решите поделиться с нами и другими читателями своим опытом использования подобной продукции, то добро пожаловать в комментарии к этой статье.

    Как выбрать подогреватель для детской бутылочки? - Доктор Комаровский


    Watch this video on YouTube

    Кому нужно покупать подогреватель бутылочек? - Доктор Комаровский


    Watch this video on YouTube

    Статья про Подогреватели детских бутылочек Philips Avent

    Подогреватели детских бутылочек Philips Avent

    Принцип работы

    Материал изготовления

    Правила эксплуатации

    Особенности подогревателей Philips Avent

    Габариты, вес

    Производитель

    Гарантия

     

     

    Подогреватели детских бутылочек Philips Avent

     

    Проблема подогрева детского питания рано или поздно встает перед всеми родителями грудничков. Даже если ребенок полностью находится на грудном вскармливании, примерно в полугодовалом возрасте в его рацион помимо материнского молока вводятся различные пюре и соки. Чтобы малыш был здоровым, и у него не болел животик, прикорм должен иметь определенную консистенцию и температуру. Вся еда для ребенка должна быть теплой, но не горячей, по температуре приближаясь к материнскому молоку.

     

    При подогреве детского питания на помощь родителям придет подогреватель детских бутылочек.

     

     

    Принцип работы

     

    Подогреватель для бутылочек работает по принципу водяной бани, то есть бутылочка помещается в специальный контейнер с водой и там нагревается, но в отличие от классической водяной бани встроенный терморегулятор не дает воде перегреться или остыть. Детское питание прогревается до нужной температуры и в сжатые сроки (до 10 минут в зависимости от объема и консистенции пищи).

     

    Подогреватель не только быстро разогревает молочные смеси и другое детское питание, но и поддерживает температуру в течение некоторого времени (около получаса) для того, чтобы к ожидаемому пробуждению малыша еда была готова, и ребенку не пришлось ждать, изводя маму голодными криками.

     

    Бутылочка не может перегреться или недогреться – электронная система контроля температуры проследит за этим. Удобно, когда в подогревателе есть функция выбора режима нагрева, так как на подогрев одного итого же количества жидкости в пластиковой бутылочке комнатной температуры, или в бутылочке со съемным дном или в толстостенной стеклянной бутылочке, которую достали из холодильника, потребуется разное количество тепла и времени разогрева.

     

    Закончив подогрев, прибор визуально сообщит (изменится цвет светового индикатора), что питание уже теплое и можно начинать кормление.

     

    Работает подогреватель для бутылочек от сети 220 В, но некоторые модели имеют специальный адаптер, позволяющий им получать питание от автомобильного прикуривателя (это позволит взять подогреватель для бутылочек в поездку и кормить ребенка по привычному графику).

     

    Прибор, как правило, рассчитан на одну бутылочку или баночку с детским питанием, более широкая емкость может не поместиться.

     

     

    Материал изготовления

     

    Подогреватели для бутылочек делают из безопасного гипоаллергенного пластика. Он устойчив к воздействию высоких температур и не может нанести вред ребенку.

     

     

    Правила эксплуатации

     

    Подогревая детское питание при помощи подогревателя для бутылочек, следует соблюдать некоторые правила. Перед эксплуатацией подогревателя необходимо ознакомиться с инструкцией по эксплуатации и следовать ее указаниям.

     

    Ставить прибор нужно только на ровную устойчивую поверхность, вне досягаемости ребенка.

     

    Нельзя хранить подогреватель для бутылочек в сыром месте или рядом с техническими приборами, не предназначенными для контактирования с пищей.

     

    Периодически необходимо очищать подогреватель для бутылочек, предварительно отключив его от сети. Внутренняя и внешняя поверхность прибора протирается влажной тряпкой после извлечения съемной чаши. Для очистки съемной чащи от накипи можно использовать раствор лимонной кислоты (10 г на 200 мл воды) или пищевого уксуса (50 мл на 100 мл воды). После очистки съемную чашу необходимо тщательно сполоснуть. Подогреватель для бутылочек нельзя погружать в воду и мыть с использованием абразивных средств.

     

    Чтобы в бачке прибора не образовывалась накипь, лучше использовать кипяченую воду.

     

    Чтобы подогреватель работал быстрее, нужно использовать воду комнатной температуры.

     

    Из соображений гигиены следует часто менять воду в бачке.

     

    Не допустимо использование прибора без воды. В случае если подогреватель уже начал работать, а воду забыли добавить, то загорится сигнальная лампочка и прибор автоматически отключится. Перед повторным включением необходимо дать подогревателю остыть, заполнив его холодной водой.

     

    Оптимальная температура детского питания – температура тела и материнского молока – около 36°C. Любое детское питание и молочные смеси нельзя подогревать больше одного раза. После подогрева детское питание необходимо перемешать перед тем, как дать ребенку. Материнское молоко нужно использовать не позже чем через три часа после разморозки.

     

    При подогреве кефира и других кисломолочных продуктов нужно быть внимательными при выборе режима работы подогревателя. Если установить его неправильно, эти продукты могут «свернуться».

     

     

    Особенности подогревателей Philips Avent

     

    Электронные подогреватели бутылочек Philips Avent автоматически вычисляют время подогревания в зависимости от типа пищи, ее количества и первоначальной температуры. Пища подогревается равномерно, без опасных точек нагрева. Автоматическое отключение не допустит перегрева.

     

    Контролируемый пар подогревает быстро и равномерно. Электронный подогреватель бутылочек Philips Avent позволяет просто, быстро и безопасно разогреть детское питание. Подогреватель бутылочек может подогреть 125 мл молока менее чем за 2 минуты.

     

    Удобный цифровой дисплей на электронном подогревателе бутылочек Philips Avent очень прост в использовании. Он позволяет следить за подогреванием и проинформирует, когда еда будет готова.

     

    Подогреватели бутылочек Philips Avent подогревают молоко и детское питание любой температуры, они могут подогревать молоко и детское питание из холодильника и даже из морозилки.

     

    Подходят для всех бутылочек Philips Avent, волшебных чашек и баночек с детским питанием.

     

     

    Габариты, вес

     

    Подогреватели Philips Avent довольно компактные приборы, сравнимые по величине с детской бутылочкой, и лишь немного превосходящие ее в размерах. Вес подогревателя вместе с упаковкой не превышает одного килограмма.

     

     

    Производитель

     

    Марка Avent появилась в Англии в 1984 г. Более четверти века компания Avent разрабатывает и производит качественную продукцию для ухода за детьми: молокоотсосы, бутылочки для кормления, стерилизаторы, машинки для стрижки волос, соски, детскую посуду и др.

     

    В сентябре 2006 г. произошло слияние компании Avent и компании Philips, мирового лидера в области новых технологий, продуктов для здоровья и повседневной жизни. Это прекрасное сочетание двух мощных компаний с богатой историей новых разработок. Стремясь повысить уровень жизни потребителей, компания Philips разрабатывает продукты для укрепления и поддержания их здоровья. Этому способствует и цель компании Avent – создать самые качественные в мире продукты для ухода за малышами. Philips Avent предлагает продукты для повседневной жизни, помогающие максимально упростить уход за ребенком.

     

    Продукция компании Philips Avent разрабатывается и производится в Великобритании на фабрике в Суффолке недалеко от Лондона, также компания имеет заводы в других странах. Исследования и разработки остаются наиболее важной частью работы. Группа разработчиков и конструкторов Philips Avent использует оригинальные тенденции, инновации и инженерно-технический опыт при создании технологий, отвечающих особым требованиям продуктов Philips Avent.

     

    Компания Philips Avent прислушивается к мнению потребителей. Обратная связь с клиентом является неотъемлемой частью постоянного мониторинга и улучшения эффективности продукции.

     

     

    Гарантия

     

    На подогреватели детских бутылочек Philips Avent предоставляется гарантия изготовителя 2 года от даты покупки.

    Dr.Brown's Подогреватель для бутылочек электрический с цифровым управлением (арт. 851)

        Видеообзор

    Прежде, чем начать пользоваться своим новым подогревателем Natural Flow® Deluxe Bottle Warmer для бутылочек, пожалуйста, внимательно прочтите ВСЮ БРОШЮРУ С ИНСТРУКЦИЯМИ, включая раздел "ВАЖНЫЕ МЕРЫ ПРЕДОСТОРОЖНОСТИ".
        Инструкция  

    Организация питания ребенка - одна из самых ответственных задач, стоящих перед родителями. Заботливые мамы и папы стараются обзавестись необходимым количеством полезных и удобных приспособлений для кормления малыша. Мировые инновации не обходят стороной счастливых родителей: производители детских товаров не перестают удивлять техническими новинками, облегчающими родительский быт и дающими возможность уделить больше времени ребенку.

    Прежде, чем начать пользоваться своим новым подогревателем Natural Flow® Deluxe Bottle Warmer для бутылочек, пожалуйста, внимательно прочтите ВСЮ БРОШЮРУ С ИНСТРУКЦИЯМИ, включая раздел "ВАЖНЫЕ МЕРЫ ПРЕДОСТОРОЖНОСТИ".

        Инструкция  

    Организация питания ребенка - одна из самых ответственных задач, стоящих перед родителями. Заботливые мамы и папы стараются обзавестись необходимым количеством полезных и удобных приспособлений для кормления малыша. Мировые инновации не обходят стороной счастливых родителей: производители детских товаров не перестают удивлять техническими новинками, облегчающими родительский быт и дающими возможность уделить больше времени ребенку.
    Три полезных приспособления помогут решить за вас задачу, связанную с подогревом, стерилизацией детских бутылочек и приготовлением пищи: подогреватель, стерилизатор и пароварка.

    Подогреватель детского питания быстро и безопасно подогреет сцеженное молоко, молочную смесь либо детское питание, равномерно и бережно, без излишнего нагрева, с сохранением всех витаминов. Подогреватель чрезвычайно удобен для приготовления питания ночью.

    Стерилизатор позволит без лишних затрат времени и усилий соблюсти режим гигиены питания младенца. Высокотемпературная обработка бутылочек, сосок и принадлежностей для кормления гарантирует уничтожение с их поверхности всех болезнетворных бактерий и микробов.

    Пароварка - устройство, позволяющее приготовить блюдо на пару. Такое питание отличается исключительной полезностью и легкостью усвояемости для организма ребенка, что подтверждается рекомендациями диетологов и педиатров.

    Подогреватель Dr.Brown's электрический с цифровым управлением разработан специально для бутылочек Dr. Brown's, включая стандартные, с широким горлышком и стеклянные. Удобен в использовании ночью.

    Особенности:

    • Простой в эксплуатации. Быстрый подогрев паром.
    • Оснащен ЖК-дисплеем с подсветкой для ночного и дневного периодов. На экране виден обратный отсчет времени.
    • Подогрев начинается после нажатия одной кнопки.
    • Легко сохранить в памяти время, необходимое для подогрева различных размеров бутылочек. Это позволяет экономить время и производить подогрев нажатием одной кнопки.
    • Нет необходимости менять воду между использованием. Съемный резервуар для воды позволяет добавлять воду каждые 6-12 циклов
    • Легко регулируемая съемная корзина (умещает бутылочки разных размеров и брендов).
    • Возможна стерилизация пустышек и предметов для кормления ребенка.
    • Крышка в верхней части нагревательной камеры остается в закрытом положении во время цикла, сохраняя пар внутри камеры. Это обеспечивает эффективный безопасный нагрев за короткое время и делает работу подогревателя более безопасной.
    • Понятное и удобное управление. Четырехкнопочная клавиатура для задания продолжительности времени подогрева и для включения/выключения подогревателя. 
    • Окончание цикла сопровождается световым и звуковым сигналом.
    • Автоотключение при перегреве.

    Дополнительно: 

    • Вход питания: 220/230В - 60 Гц
    • Размер: 15 х 18 х 35см
    • Мощность: 300Вт
    • Инструкция на русском языке

    Гарантия 12 месяцев.

     

    11 лучших обогревателей, которые вы можете получить менее чем за 100 долларов

    С более прохладными температурами на горизонте (привет, зимние пальто и зимние ботинки) обогреватель станет желанным дополнением к любому дому.

    Чтобы узнать больше о обогревателях и получить рекомендации по лучшим моделям для каждого дома, мы обратились к Лу Манфредини, ведущему «HouseSmarts», и Рэнди Лайту и Чаду Хайленду, продавцам портативного обогревателя в Home Depot.

    Что такое обогреватель?

    "Обогреватель - это прибор, предназначенный для обогрева закрытых помещений.Есть много стилей и типов портативных обогревателей на выбор, включая напольные обогреватели, персональные обогреватели, обогреватели плинтусов и стен », - сказал Хайленд СЕГОДНЯ.

    Что делает обогреватель?

    На базовом уровне все пространство Обогреватели нагревают пространство, в котором они размещены. Однако каждый тип поможет нагреть пространство по-своему, сказал Хайленд. Он разбил четыре различных типа и то, как они работают.

    1. Керамические обогреватели: "Тип A В конвекционных обогревателях керамические обогреватели нагревают воздух, когда он обдувает горячую керамическую пластину или змеевики внутри устройства.Корпус обогревателя остается прохладным на ощупь, что делает его популярным в домах с детьми и домашними животными », - сказал Хайленд.
    2. Нагреватели с принудительной циркуляцией воздуха: « Эти конвекционные обогреватели, также называемые вентиляторными обогревателями, нагревают воздух и распространите его по комнате вентилятором. Вентилятор позволяет быстро распределять тепло. "Нагреватели с принудительной подачей воздуха популярны в офисах или небольших рабочих помещениях", - сказал Хайленд.Они идеально подходят для гостиной, спальни или кабинета и, как правило, дольше сохраняют тепло, даже когда питание отключено », - сказал Хайленд.
    3. Инфракрасные обогреватели: « Тип лучистого обогревателя, как правило, инфракрасные обогреватели. более эффективен для обогрева человека или небольшого участка, нежели помещения большего размера. Вы можете увидеть их в спальне или даже под столом, если вам всегда холодно в офисе », - сказал Хайленд.

    Каковы преимущества обогревателя?

    Хайленд поделился, что« обогреватель может сэкономить вы деньги и энергию, потому что нагревает только ту комнату или пространство, которое используется. «

    Как выбрать безопасный обогреватель?

    Теперь, когда вы знаете все о том, что такое обогреватели и что они делают, как выбрать безопасный, но мощный обогреватель? Манфредини, Лайт и Хайланд рассказали о некоторых из них. наиболее важные вещи, на которые следует обратить внимание при выборе обогревателя.

    1. Подумайте о том, какую комнату вы пытаетесь обогреть. Лайт и Хайланд объяснили, что обогреватели бывают разных размеров для разных помещений, включая большую комнату обогреватели, настольные обогреватели и уличные обогреватели.Сузьте варианты выбора помещения, которое вы хотите обогреть, чтобы найти продукт, специально соответствующий вашим потребностям.
    2. Учитывайте количество потребляемой энергии. Ищите обогреватель мощностью от 750 до 1000 Вт. «Все обогреватели утверждают, что они самые эффективные, но большинство из них потребляют одинаковое количество энергии», - предупредил Манфредини.
    3. Выберите стиль для своего обогревателя. Вы хотите, чтобы обогреватель гармонично вписался в интерьер комнаты, или вы покупаете его исключительно как функциональное устройство? Лайт сказал, что стиль стал более важным фактором принятия решений в последние несколько лет, и многие бренды обогревателей обновили свой внешний вид.
    4. Выберите, какие дополнительные функции вам необходимы. Некоторые устройства поставляются с дистанционным управлением, термостатами и возможностью колебания, сказал Хайланд.
    5. Помните о пожарной безопасности. При неправильном использовании обогреватели могут представлять опасность для пожарной безопасности. Комиссия по безопасности потребительских товаров США рекомендует всегда держать обогреватели на расстоянии не менее трех футов от легковоспламеняющихся предметов, таких как занавески или постельные принадлежности. Вам также следует воздерживаться от подключения переносных обогревателей к удлинителю или удлинителю, чтобы снизить риск возгорания. Также убедитесь, что устройства имеют рейтинг безопасности UL или ETL, - сказал Манфредини.

    Вот несколько лучших обогревателей для внутренних и наружных помещений, по мнению экспертов.

    Лучший компактный обогреватель

    Керамический обогреватель Lasko с регулируемым термостатом

    С саморегулирующимся термостатом, тремя настройками (высокая температура, низкая температура и вентилятор) и функциями безопасности, такими как автоматическая защита от перегрева, Лайт и Хайланд предложили это девять- дюймовый обогреватель для небольших комнат или рабочего стола.

    Лучший обогреватель плинтуса

    Низкопрофильный бесшумный обогреватель Lasko

    «Электрические обогреватели плинтуса - отличные дополнительные устройства, которые можно разместить под окнами, где потери тепла самые высокие», - сказал Манфредини.

    Лучший пропановый обогреватель

    Переносной пропановый обогреватель Mr. Heater Buddy

    Хотя большинство пропановых обогревателей предназначены для использования на улице, это один из немногих газовых обогревателей, которые можно безопасно использовать в помещении, заявили в Hyland and Light.

    Для него не требуется электричество, потому что он работает на баллоне с пропаном на один фунт, поэтому он идеально подходит для тех, у кого есть внутреннее пространство для обогрева, в котором нет электричества.Он также может служить в качестве личного обогрева во время осенних и зимних занятий на открытом воздухе.

    Обогреватель с лучшим дизайном

    Башенный бесколлекторный обогреватель Lasko с дистанционным управлением

    «У меня действительно есть (этот обогреватель) в моей главной спальне. Я думаю, что это самый красивый обогреватель, который у нас есть, - сказал Хайленд. Этот обогреватель не только стильный, но и колеблется, чтобы равномерно распределять тепло по комнате.

    Лучший электрический каминный обогреватель

    Крановый каминный обогреватель

    “Крановый каминный обогреватель предлагает электрическое отопление помещения, но с реалистичным видом небольшого камина. [Это] лучшее из обоих миров, и он может расслабить гостиную, спальню или семейную комнату », - сказал Манфредини.

    Примечание редактора: этой модели в настоящее время нет в наличии, хотя аналогичная версия от Hampton Bay в настоящее время доступна за 59 долларов.

    Лучший маслонаполненный обогреватель

    PELONIS Electric 1500 Вт Масляный радиаторный обогреватель

    «Масляные обогреватели помещения обеспечивают остаточное тепло и фактически могут стоить меньше в эксплуатации. Они используют ту же мощность, что и большинство других обогревателей, но как только масло нагревается и достигается температура, агрегат отключается, но нагревательное масло в агрегате продолжает выделять тепло », - сказал Манфредини.

    Лучшее соотношение цены и качества обогреватель

    Hunter Home Comfort 18-дюймовый керамический башенный обогреватель

    Этот башенный обогреватель может выглядеть не так красиво, как некоторые другие, но он легко нагревает средние и большие комнаты за небольшую часть стоимости. и Хайленд сказал.

    Лучший обогреватель для больших помещений

    Lasko Cyclonic Digital Ceramic Heater

    Этот обогреватель использует циклонное тепло для быстрого обогрева больших помещений. Обогреватель сначала втягивает более холодный воздух через нижнюю часть устройства и распределяет тепло дальше в комнату сверху.Его функциональность также улучшена благодаря сенсорным элементам управления и легко очищаемому фильтру.

    Самые продаваемые обогреватели для помещений по доступной цене

    1. Керамический обогреватель Honeywell UberHeat

    Этот керамический напольный обогреватель от Honeywell, выполненный в современном стиле середины века, отличается стилем, функциональностью и энергоэффективностью. Несмотря на то, что он производит много тепла, его внешний вид остается прохладным на ощупь.

    2. Портативный электрический обогреватель GiveBest

    Рецензентам Amazon нравится этот популярный портативный обогреватель за его легкий дизайн и высокоскоростной вентилятор, способный обогреть комнату площадью 200 квадратных футов за считанные минуты. Он также оснащен защитой от опрокидывания, которая отключает прибор в случае его случайного опрокидывания.

    3. Обогреватель для всей комнаты NewAir

    Хотя эта модель больше похожа на динамик, чем на обогреватель, она обеспечивает тихое тепло и комфорт, регистрируя звук чуть ниже 45 децибел. Он также включает в себя легко читаемый ЖК-дисплей, пульт дистанционного управления, который позволяет вам устанавливать температуру в вашем доме до идеального тепла, и встроенные функции безопасности, такие как защита от перегрева.

    Эта статья была первоначально опубликована окт.16, 2018.

    Чтобы узнать больше о зимних рекомендациях, посетите:

    Чтобы узнать больше предложений, советов по покупкам и недорогих рекомендаций по продуктам, загрузите новое приложение TODAY и подпишитесь на нашу новостную рассылку Stuff We Love!

    11 лучших обогревателей, которые можно купить в 2021 году, по мнению экспертов

    По мере того, как температура в Америке продолжает падать, обогреватели могут стать полезным бытовым прибором, быстрым и экономичным способом согреться. Эти портативные устройства позволяют эффективно обогреть любую комнату в доме или даже на улице.Кроме того, снижение температуры, а также нормальная работа из дома и рост числа случаев заражения Covid-19 вынуждают все больше и больше людей находиться в помещении и чаще в этом сезоне.

    ПРОПУСТИТЬ ВПЕРЕД Как купить обогреватели

    Если вы хотите безопасно общаться, обогреватели на открытом воздухе могут сделать сбор на улице более комфортным. Конечно, при любом собрании - от сидения у костра до похода - следует соблюдать обычные правила социального дистанцирования и меры безопасности в противном случае, от масок для лица до дезинфицирующих средств для рук.«Обогреватели открытого пространства - отличный способ согреть участки вашего двора или патио, чтобы вы могли собираться вместе с друзьями и семьей, даже когда дни становятся прохладнее», - сказал Бейли Карсон, руководитель отдела уборки и улучшения дома в Handy.

    Сопутствующие товары

    Лучшие обогреватели для магазинов

    Чтобы помочь вам составить представление о лучших вариантах обогревателей, вот некоторые из лучших в разных ценовых категориях, в соответствии с рекомендациями экспертов выше, которые мы сравнили с некоторыми лучшими. оцененные модели у различных крупных розничных продавцов.

    Лучшая комбинация обогревателей: Vornado

    1. Портативный обогреватель Vornado Vh300

    Vornado Vh300 - это относительно доступный обогреватель, который обеспечивает почти мгновенную заданную температуру, способную равномерно распределять тепло в комнате. «Он также предлагает функции защиты от перегрева, защиту от опрокидывания, а внешняя пластиковая крышка остается прохладной», - сказал Гленн Вайзман, менеджер по продажам Top Hat Home Comfort Services. Кроме того, он компактен, поэтому его можно легко убрать, когда вы им не пользуетесь.

    Лучший инфракрасный обогреватель для семей: Dr. Infrared Heater

    2. Инфракрасный обогреватель Portable Space Heater

    Отмечая его вариант энергосбережения, двойную систему обогрева и встроенный термостат, который колеблется от 50 до 85 градусов, Wiseman рекомендует эту портативную модель. «Обогреватель питается от проводной электрической сети напряжением 120 вольт, которая может равномерно обогреть всю комнату», - добавил он.

    Лучший недорогой обогреватель: Lasko

    3. Переносной керамический обогреватель Lasko

    Идеально подходит для спальни или других небольших помещений, этот обогреватель имеет три тихих режима - высокий, низкий и режим вентилятора.«Есть 11 различных температурных режимов и удобная ручка для переноски», - добавил Барретт. «Функции безопасности тоже отличные, и они уже есть». Новый электрический циклонный керамический нагреватель консоли Lasko включает в себя многофункциональный пульт и два различных режима бесшумного нагрева, а также таймер сна и другие примечательные особенности.

    Соответствующий

    Лучший обогреватель высокого класса: Dyson

    4.

    Вентилятор Dyson Hot + Cool Jet Focus AM09

    Dyson Hot + Cold - это эффективный обогреватель, обеспечивающий круглогодичный контроль климата.«Эта эффективная система позволяет вам выбирать между сфокусированными или рассредоточенными настройками для использования в качестве личного обогревателя или для обогрева всего помещения», - сказал Вайзман. «Этот портативный обогреватель практически бесшумен и предлагает возможность осушения». Действительно, QuietMark включает эту модель Dyson в число отмеченных наградами малошумных обогревателей.

    Лучший обогреватель для внутреннего / наружного использования: Mr. Heater

    5. Mr. Heater MH9BX Buddy Безопасный для помещений портативный пропановый излучающий обогреватель

    Удобен как для наружного, так и для внутреннего использования. с опрокидыванием и может обогревать помещения размером до 225 квадратных футов.«Он полностью эффективен и экологически чист, имеет функцию автоматического отключения и портативный», - сказал Барретт.

    Лучший обогреватель для спальни: KopBeau

    6. Масляный обогреватель радиатора KopBeau мощностью 1500 Вт

    Лучший выбор Ван Туйла для спален - пропановый обогреватель для помещений KopBeau. Эта модель с конвекцией на жидком топливе имеет четыре режима нагрева, дистанционное управление и современные средства безопасности. Чтобы свести к минимуму ваши расходы на коммунальные услуги, он также имеет интеллектуальный эко-режим, который переключается между максимальным и минимальным значением, чтобы поддерживать температуру в помещении при одновременном снижении потребления энергии.

    Связанный

    Лучший обогреватель для больших помещений: Lifesmart

    7. 6-элементный обогреватель Lifesmart

    Для больших помещений Ван Туйл рекомендует инфракрасный обогреватель Lifesmart с максимальной мощностью 1500 Вт. Он включает в себя пульт дистанционного управления, 12-часовой таймер, три различных режима нагрева и даже «экономичный режим» мощностью всего 500 Вт, если вы хотите перенести его в небольшую комнату.

    Лучшее компактное отопление помещений: Andily

    8. Электрический обогреватель Andily

    Керамический обогреватель Andily - это недорогая модель, которая идеально подходит для использования дома или в офисе.«Он красивый и компактный, но при максимальной мощности может обеспечить колоссальные 1500 Вт», - сказал Ван Туйл.

    Лучший панельный обогреватель: De'Longhi

    9. Термический панельный обогреватель De'Longhi Mica

    Не позволяйте элегантному дизайну вводить вас в заблуждение, этот легкий обогреватель обладает мощной мощностью 1500 Вт тепла. «Этот обогреватель можно легко установить на любую стену, обеспечивая регулируемый термостат с несколькими вариантами управления обогревом, который позволяет вам настраиваться на подходящую температуру», - сказал Вайзман.

    Сопутствующие

    Другие обогреватели, которые следует учитывать

    10. Башенный электрический обогреватель Lasko

    Вместо традиционного вентилятора, используемого во многих из вышеперечисленных вариантов, этот обогреватель Lasko отличается безлопаточной конструкцией, как у моделей Dyson . Он оснащен множеством функций безопасности, включая безопасную сенсорную поверхность и автоматический выключатель. Благодаря тихому колебательному режиму изящная башня может равномерно распределять тепло в помещениях площадью до 300 квадратных футов.

    11. TaoTronics PTC 1500W Space Heater

    Если главное в игре - скорость, TaoTronics поможет вам. Этот обогреватель может нагреться до 70 градусов по Фаренгейту за три секунды и имеет колебания из стороны в сторону для лучшего распределения тепла. Кроме того, он имеет три режима нагрева и включает датчики защиты от перегрева, а также автоматический выключатель.

    Сопутствующие

    Что такое обогреватель и нужен ли он?

    Обогреватели - это портативные устройства, предназначенные для обогрева отдельных комнат, а не целых домов, - объяснил Ари Ван Туйл, лицензированный домашний инспектор и основатель Home Inspector Secrets.«Самое замечательное в обогревателях - это то, что домовладельцы могут использовать их« по мере необходимости », не включая термостат HVAC», - сказал он. «Фактически, домовладельцы могут захотеть снизить температуру на термостате, если вы хотите обогреть только одну комнату и сэкономить на расходах на электроэнергию».

    Преимущества обогревателей

    Помимо своей основной функции нагревания, обогреватели могут доказать свою ценность множеством других способов.

    Обогреватели работают быстрее. Обогреватель требует меньше времени для распределения тепла и тепла в помещении по сравнению с системой отопления, вентиляции и кондиционирования воздуха, пояснил Уайзман.«Центральному отоплению часто требуется некоторое время, чтобы достичь заданной температуры», - сказал он. «Это удобный способ быстро повысить температуру в помещении и добавить тепла любому необходимому пространству».

    Обогреватели соответствуют . Обогреватели также могут поддерживать одну и ту же температуру в помещении столько, сколько вы хотите, что позволяет легко и быстро выключить его и отключить тепло.

    У них много вариантов, чтобы удовлетворить самые разные потребности. От обогревателей для внутренних и наружных помещений до различных доступных размеров и стилей - бесчисленное множество моделей обогревателей позволяют согреться по-разному - и по разной цене.

    Обогреватели могут сэкономить вам деньги. Вместо того, чтобы платить за обогрев всего дома и поддержание его тепла, обогреватели выступают в качестве дополнения к вашей основной системе отопления, вентиляции и кондиционирования воздуха, повышая температуру в конкретном помещении, в котором вы проводите время.

    «Основные преимущества помещения - это то, что он сократит ваши расходы на коммунальные услуги и обеспечит нужную температуру в помещении, когда это необходимо », - сказала Натали Барретт, руководитель отдела качества услуг в Nifty Cleaning Services.

    Связанные

    Типы обогревателей

    Существуют три основных типа обогревателей, каждый из которых предназначен для обогрева вашего помещения разными способами. «Лучистые обогреватели обычно используются для обогрева людей, конвекционные обогреватели нагревают фактический воздух в комнате, а комбинированный обогреватель дает вам возможность использовать оба варианта», - пояснил Карсон.

    Сияющий. Вместо того, чтобы нагревать воздух во всей комнате, лучистые обогреватели быстро превращают электричество в лучистую энергию для обогрева предметов или людей перед ними.«Они лучше всего подходят, если вы хотите очень быстро нагреть область, и обычно используются в качестве« точечных обогревателей », то есть они будут нагревать только определенную область, на которую [они] указали», - сказал Уайзман.

    Важным преимуществом этих обогревателей для всех, кто работает дома, является то, что они бесшумны и имеют минимальное количество движущихся частей. Это также означает, что они с меньшей вероятностью сломаются. Сказав это, они также могут представлять опасность пожара, поскольку становятся горячими - и они могут быть не лучшими для вашего сна. «К сожалению, они обычно имеют оранжевое свечение и могут не работать в спальнях», - добавил Ван Туйл.

    Конвекционные обогреватели. В конвекционных установках горячий воздух поднимается и падает, чтобы бесшумно рассеивать тепло без использования вентилятора. Хотя этим обогревателям требуется больше всего времени для обогрева комнаты, они идеально подходят, если вашей целью является равномерное распределение тепла. К распространенным конвекционным моделям относятся плинтусы и маслонаполненные обогреватели. «Однако конвекционные обогреватели могут не подходить для домов с маленькими детьми, потому что они становятся горячими на ощупь», - отметил Ван Туйл. «Эти устройства также обычно поставляются с пультами дистанционного управления и могут колебаться в направлении.”

    Комбинированные обогреватели. В этих обогревателях используется вентилятор для рассеивания тепла, поэтому они работают быстрее, но не бесшумны. «Эти обогреватели хороши тем, что они недостаточно нагреваются, чтобы вызвать пожар или ожог, и нет раздражающего оранжевого свечения», - сказал Ван Туйл. «Однако большой недостаток обогревателей с вентилятором заключается в том, что они могут сушить кожу, создавая при этом фоновый шум».

    Связанные

    Как купить обогреватель

    Первый шаг при покупке обогревателя - это выяснить размер области, которую вы планируете обогревать.Для небольших помещений (которые обычно считаются 120 квадратных футов или меньше) Ван Туйл обычно рекомендует покупать обогреватель мощностью от 500 до 1000 Вт и от 1000 до 1500 Вт для больших помещений. Некоторые другие ключевые особенности, на которые следует обратить внимание при совершении покупок, включают:

    • Энергоэффективность. Вы захотите сравнить эффективность разных моделей, чтобы убедиться, что вы не слишком увеличиваете счет за электроэнергию.
    • Уровень шума . Некоторые устройства громче других.Если вы покупаете спальню или собираетесь работать днем, об этом следует помнить. Одним из ресурсов для поиска особенно тихих устройств является Quiet Mark, который тестирует и награждает продукты на основе их уровня шума.
    • Средства безопасности. Обогреватели могут быть потенциально опасными для возгорания, поэтому не упускайте из виду встроенные функции, призванные уменьшить эту вероятность. «Обязательно купите тот, у которого есть защитные решетки, а также возможность автоматического отключения [на случай] опрокидывания или перегрева обогревателя», - сказал Карсон.
    • Гарантия. Не забудьте изучить варианты гарантии. «Таким образом, вы можете защитить свои инвестиции в случае чего», - добавил Уайзман.

    Связанные

    Следите за последними новостями из руководств и рекомендаций NBC News по покупкам и загрузите приложение NBC News для полного освещения вспышки коронавируса.

    7 лучших гаражных обогревателей 2021 года

    Наши редакторы самостоятельно исследуют, тестируют и рекомендуют лучшие продукты; вы можете узнать больше о наших процесс обзора здесь.Мы можем получать комиссию за покупки, сделанные по выбранным нами ссылкам.

    Работаете ли вы над столярным проектом или ремонтируете свою любимую машину, работа в гараже зимой не идеальна (ничто не может помешать вашей работе, как онемевшие пальцы или громоздкие слои одежды!).

    Хотя существует множество способов обогреть гараж зимой, установка обогревателя, вероятно, является одним из самых удобных вариантов. Вы можете выбрать как газовую, так и электрическую модели или выбрать обогреватель с прямым выпуском воздуха, если в вашем доме уже есть трубопровод для пропана или природного газа.

    Какими бы ни были ваши потребности, мы исследовали лучшие обогреватели для гаража, которые можно добавить в ваше пространство. Читайте наши лучшие выборы.

    Окончательный вердикт

    Если вы ищете надежный гаражный обогреватель, который не будет мешать вам, лучшим выбором будет потолочный электрический обогреватель Fahrenheat мощностью 5000 Вт (см. На сайте Home Depot). Те, у кого нет электропроводки в гараже, могут захотеть выбрать вариант с газовым двигателем, такой как термостатический гаражный обогреватель Dyna-Glo Blue Flame без вентиляции (см. Walmart), который способен обогревать до 1000 квадратных футов .

    Тип

    Двумя наиболее распространенными типами обогревателей для гаражей являются газовые и электрические. Обогреватели природного газа очень экономичны, но они занимают много места и требуют тщательной очистки. С другой стороны, электрические обогреватели более компактны и требуют меньшего обслуживания. Тип обогревателя, который вы выберете, будет зависеть от того, к чему у вас есть доступ, насколько велико ваше пространство, и от ваших личных предпочтений.

    Мощность

    Проверьте BTU и мощность гаражного обогревателя, чтобы убедиться, что он нагревает все ваше рабочее пространство.Если вы обогреваете большее пространство, например гараж на несколько автомобилей, то лучшим выбором будет поиск обогревателя большего размера. Также учитывайте напряжение гаражного обогревателя. Если нагреватель включается, убедитесь, что он не сработает в розетках в вашем доме.

    Характеристики

    Многие обогреватели для гаража обладают замечательными функциями, обеспечивающими простоту использования и вашу безопасность. От колес и защиты от перегрева до холодного корпуса и опрокидывающегося переключателя - есть множество функций, которые следует учитывать.Эти функции могут быть особенно важны, если вы планируете перемещать обогреватель. Вы не хотите обжечь руку, поднимая ее, или беспокоиться о том, что она может вызвать пожар, если она случайно опрокинется.

    Шум

    Некоторые обогреватели для гаража могут быть очень шумными, поэтому перед покупкой проверьте их характеристики. Если вы предпочитаете тихое рабочее место или беспокоитесь о том, чтобы разбудить других в своем доме, лучше всего подойдет электрический обогреватель, так как их газовые аналоги обычно более шумные.

    Эта статья была исследована и отредактирована Лили Сперри, писателем, посвященным образу жизни, и коммерческим редактором журнала The Spruce.Обдумывая лучшие варианты для включения, она ознакомилась с десятками отзывов клиентов и комментариями со сторонних веб-сайтов.

    7 лучших обогревателей, чтобы согреться этой зимой

    При выборе лучшего обогревателя нужно учитывать множество факторов. Во-первых, вам нужно учитывать, насколько большое пространство вы хотите отапливать, поскольку обогреватели имеют разную тепловую мощность. Вы также захотите проанализировать энергоэффективность, чтобы обогреватели не сильно повредили ваши счета за электроэнергию.А поскольку цены на обогреватели варьируются в зависимости от бюджета, вам нужно иметь четкое представление о том, сколько вы планируете потратить, прежде чем выбрать свой любимый вариант.

    Amazon

    Некоторые другие особенности, такие как поддержка дистанционного управления и габаритные размеры, также следует учитывать, прежде чем покупать обогреватель. Дизайн также является важным компонентом при принятии решения о покупке. Поскольку обогреватели должны быть в комнатах, в которых вы находитесь, вы должны убедиться, что они действительно красиво выглядят и не отвлекают от вашего декора.(Поверьте, не все обогреватели имеют красивый дизайн.)

    БОЛЬШЕ ОТ FORBEST Лучшие очистители воздуха для чистого воздуха в вашем доме Автор: Дэйв Джонсон

    В конечном счете, если вы хотите купить новый обогреватель, то, возможно, потребуется некоторое время, чтобы найти подходящий. Но чтобы помочь вам избавиться от догадок, мы составили этот список лучших обогревателей на данный момент. Все устройства, представленные ниже, получают хорошие отзывы и отзывы пользователей и предоставляют множество функций по цене, соответствующей любому покупателю.


    Лучший обогреватель пространства в целом

    Dyson Hot + Cool Jet Focus AM09 Тепловентилятор

    • Размеры: 8,03 x 6,02 x 23,4 дюйма
    • Источник питания: Проводной электрический
    • Метод нагрева: Принудительный воздух
    • Варианты цвета: Черный / Никель

    Если вы ищете лучший обогреватель на рынке, обратите внимание на обогреватель с вентилятором Dyson Hot + Cool Jet Focus AM09. Устройство, которое имеет один из самых привлекательных дизайнов в этом обзоре, обладает способностью с легкостью обогревать комнаты благодаря функции интеллектуального термометра, который может точно анализировать температуру в помещении и реагировать соответствующим образом.А поскольку он блокирует попадание пыли на нагревательные элементы, Dyson не обещает запаха гари.

    Некоторые пользователи не согласились с его ценой, но многие согласны с тем, что он стоит денег, отмечая, что он работает быстро и хорошо, с множеством приятных функций. Если вы не против потратиться, обогреватель с вентилятором Hot + Cool Jet Focus AM09 от Dyson - один из лучших обогревателей.

    Промокоды Amazon | 10% скидка в ноябре 2020 года | Forbes

    Лучший бюджетный обогреватель

    Vornado Vh302 Обогреватель личного пространства

    • Размеры: 7.2 x 7,9 x 7,1 дюйма
    • Источник питания: Проводной электрический
    • Метод нагрева: Принудительный воздух
    • Варианты цвета: Черный
    Обогреватель личного пространства

    Vornado Vh302 - лучший выбор для небольших помещений. Устройство с красивым дизайном, «размером с ананас», по словам одного из обозревателей, обеспечивает тихую работу и использует вихревую циркуляцию воздуха для быстрого нагрева воздуха вокруг вас. Он также оснащен защитой от опрокидывания, что снижает вероятность получения травмы, и имеет пластиковую отделку, которая не нагревается при прикосновении.

    , по мнению пользователей, эффективен для обогрева офисных помещений, рабочих кухонь и спален, а также для обогрева крыльца в зимние месяцы.


    Лучший обогреватель для небольших помещений

    Vornado Vh20 Вихревой нагреватель

    • Размеры: 11,7 x 9,3 x 12 дюймов
    • Источник питания: Проводной электрический
    • Метод нагрева: Принудительный воздух
    • Варианты цвета: Черный

    Еще одна замечательная модель Vornado, вихревой нагреватель Vh20 от компании - хороший выбор для быстрого обогрева небольших помещений.Он больше, чем Vh302, но имеет почти идентичный дизайн и может легко обогревать небольшие и средние комнаты. Он имеет два режима нагрева - низкий и высокий - и обладает той же защитой от опрокидывания, что и его меньшая альтернатива.

    Он отдает тепло за счет вихревого нагрева и использует циркуляцию воздуха, поэтому не выделяет интенсивное и неприятное тепло. Пользователи говорят, что устройство быстро нагревается и делает это довольно тихо. Лучше всего то, что это один из самых доступных обогревателей на рынке, что делает его очень выгодным для большинства пользователей.


    Лучший обогреватель для больших помещений

    Dyson Pure Hot + Cool, HP01

    • Размеры: 8,7 x 6,06 x 24,88 дюйма
    • Источник питания: Проводной электрический
    • Метод нагрева: Принудительный воздух
    • Варианты цвета: Белый / Серебристый

    Если внешний вид занимает первое место в вашем списке, то Dyson Pure Hot + Cool HP01 может быть лучшим обогревателем на рынке. Устройство выполнено в высококачественном серебристо-белом цвете с привлекательной металлической отделкой, что делает его подходящим для большинства помещений.Конечно, дело не только в внешности. Dyson Pure Hot + Cool HP01 также получил высокие оценки за функциональность.

    Он обеспечивает принудительный подогрев воздуха и даже имеет режим очистки, который удаляет из воздуха аллергены, плесень и другие загрязнители. Пользователи особенно впечатлены его способностью нейтрализовать запахи в комнате и говорят, что включенный в него пульт дистанционного управления и интеграция с приложением Dyson делают его очень привлекательным вариантом для бездельника.


    Лучший обогреватель для быстрого нагрева

    TaoTronics PTC 1500W Керамический башенный нагреватель с быстрым тихим нагревом

    Amazon

    TaoTronics PTC, 1500 Вт, качающийся портативный обогреватель с дистанционным управлением

    КУПИТЬ В AMAZON
    • Размеры: 7.72 x 7,2 x 23,82 дюйма
    • Источник питания: Проводной электрический
    • Метод нагрева: Принудительный воздух
    • Варианты цвета: Черный

    Если вы хотите быстро обогреть холодную комнату, портативный обогреватель TaoTronics PTC может быть лучшим вариантом для вас. Он оснащен технологией быстрого реагирования, которая позволяет ему нагреться до 70 градусов по Фаренгейту всего за три секунды. Отсюда он может достичь новых высот и в кратчайшие сроки обеспечить превосходное отопление помещений.

    Этот обогреватель с очень высоким рейтингом (4,8 от чуть более 2100 рецензентов) имеет более вертикальную конструкцию, чем некоторые другие обогреватели на рынке, но имеет более широкий диапазон нагрева. Он также поставляется с пультом дистанционного управления для легкого управления и может быть настроен на работу до 24 часов, прежде чем он автоматически отключится.


    Best Oil Space Heater

    Aireplus 1500W Масляный электрический обогреватель радиатора

    • Размеры: 26,4 x 15.4 x 6,4 дюйма
    • Источник питания: Проводной электрический
    • Метод нагрева: Масло
    • Варианты цвета: Черный

    В отличие от многих других обогревателей в этом обзоре, масляный радиаторный электрический обогреватель Aireplus 1500 Вт использует масло для обогрева помещения. Он поставляется с тремя настройками нагрева, которые варьируются от 40 градусов по Фаренгейту до 95 градусов по Фаренгейту. А с 24-часовой настройкой вы можете позволить ему работать весь день, прежде чем вам потребуется его сбросить.

    Он получил высокие оценки среди пользователей, многие из которых считают, что интеграция с маслом является долгожданным дополнением, и устройство работает довольно тихо в течение ночи. Он также поставляется с колесами для удобной транспортировки по дому.


    Лучший обогреватель радиатора

    Масляный обогреватель радиатора De'Longhi

    • Размеры: 5,9 x 13,78 x 24,9 дюйма
    • Источник питания: Проводной электрический
    • Метод нагрева: Радиант
    • Варианты цвета: Белый
    Радиаторы

    , возможно, не самый популярный вариант отопления в настоящее время, но подогреватель масляного радиатора De’Longhi заслужил солидные отзывы - 4.3/5 из почти 4000 оценок - за высококачественное лучистое отопление. Устройство, которое использует масло для обогрева пространства, не требует какой-либо сборки, и, поскольку его масло постоянно герметично, вам не нужно беспокоиться о его заправке.

    Нагреватель имеет множество настроек температуры и семь ребер для отвода тепла. Он также поставляется с колесами, поэтому вы можете легко перемещать его между комнатами, чтобы сохранить весь дом в тепле.

    Газовые и электрические обогреватели в Ace Hardware

    Нагреватели для тепла и комфорта

    По мере того, как температура падает и наступает более холодное время года, наличие электрического обогревателя или газового обогревателя под рукой дает вам больше контроля над вашим комфортом и вашими счетами за электроэнергию.Купите Ace Hardware прямо сейчас, чтобы найти лучший обогреватель для вашего помещения.

    Электрические обогреватели

    Электрический обогреватель - это простое решение ваших отопительных нужд. Все, что вам нужно, это розетка, чтобы начать прогревать комнату. Ищите варианты со встроенными функциями безопасности, такими как прохладный внешний вид, защита от перегрева, автоматические системы аварийного отключения, защита от опрокидывания и регулируемые термостаты, которые помогут защитить ваш дом, вашу семью и себя во время использования. При выборе лучшего электрического обогревателя учитывайте эти полезные советы:

    • Определите площадь помещения, которое вы хотите отапливать, и сравните обогревательные возможности каждого продукта перед покупкой.
    • Обратите внимание на дизайн с удобными ручками для переноски, которые позволяют легко переносить устройство из одной комнаты в другую.
    • Лучшие товары для магазинов, разработанные для бесшумной работы.

    Газовые обогреватели

    В нашем ассортименте газовых обогревателей имеется множество источников топлива. Приобретите бензиновые обогреватели, керосиновые обогреватели, пропановые обогреватели и многое другое, чтобы найти лучшее решение для вашего помещения. Во время совершения покупок обратите внимание на следующие особенности:

    • Керосиновые обогреватели с высокими значениями БТЕ для бесшумного, быстрого и эффективного нагрева.
    • Продукты, способные согреть до 5 500 квадратных футов.
    • Многотопливные обогреватели, предлагающие мощное, но бесшумное решение для обогрева.

    Лучистое тепло и конвекционное тепло

    Существует два основных типа переносных обогревателей: лучистые обогреватели и конвекционные обогреватели. Узнайте больше о каждом типе, чтобы определить, какой из них лучше всего подходит для ваших нужд.

    Излучающие обогреватели

    Большинство небольших обогревателей помещений являются излучающими обогревателями. Они идеально подходят для размещения рядом с кроватью или рабочим местом, но менее полезны для сохранения тепла во всем помещении.Лучистые обогреватели:

    • Используются для обогрева небольших определенных участков в помещении.
    • Лучше для нагрева воздуха прямо перед обогревателем.
    • Не так эффективен при обогреве всего помещения по сравнению с конвекционным обогревателем.

    Конвекционные обогреватели

    Конвекционные обогреватели непрерывно втягивают воздух над нагревательным элементом для увеличения тепла в помещении. Если вы хотите поддерживать более высокую температуру в течение длительного периода времени, конвекционные обогреватели - лучший выбор.Конвекционные обогреватели могут:

    • На то, чтобы обогреть комнату, нужно время, но это происходит более последовательно, чем у лучистых обогревателей.
    • Используйте вентиляторы, чтобы обогреть пространство.
    • Часто используется в режимах работы только с вентилятором, чтобы вы чувствовали себя комфортно круглый год.

    Знайте свою площадь в метрах

    Переносные обогреватели предназначены только для обогрева определенного пространства. Если ваше пространство больше, чем квадратные метры, указанные на обогревателе, вы можете не достичь желаемой температуры.Прежде чем измерять комнату, имейте в виду, что высокие потолки могут привести к неадекватным характеристикам, поскольку требуется обогревать большую площадь.

    Ace Hardware - ваш источник портативных обогревателей. Просмотрите нашу подборку электрических обогревателей, газовых обогревателей и керосиновых обогревателей в Интернете, чтобы найти подходящий вариант для ваших отопительных нужд.

    Лучшие электрические гаражные обогреватели для работы в холодную погоду

    Фото: depositphotos.com

    Холодные дни могут превратить ваш гараж в холодное, неудобное и непродуктивное рабочее место.Электрический обогреватель для гаража может согреть и поджарить ваш гараж, чтобы вы могли продолжать работать с комфортом, независимо от температуры наружного воздуха. Электрические гаражные обогреватели питаются от электрического соединения через розетку, что позволяет легко настроить их для использования в любом гараже с проводом или с удлинителем, идущим к ближайшей розетке.

    Лучший электрический гаражный обогреватель для вашего гаража или мастерской будет зависеть от ваших требований к пространству, типа обогревателя, который вы хотите, и необходимых вам функций безопасности.Взгляните на продукты ниже, которые представляют одни из лучших электрических обогревателей для гаражей в каждой соответствующей категории по качеству, функциональности и общей стоимости.

    1. ЛУЧШИЙ В ЦЕЛОМ: Fahrenheat FUH Electric Heater for Garage
    2. RUNNER UP: Lasko 755320 Ceramic Space Heater
    3. ЛУЧШИЙ ПОРТАТИВНЫЙ: Aikoper Space Heater
    4. НАИЛУЧШЕЕ ОБЪЕМНОЕ ОБОРУДОВАНИЕ НА СТЕНЕ Nu: Highan-Broan- Настенный обогреватель
    5. НАИЛУЧШИЙ ПОТОЛОЧНЫЙ: Comfort Zone CZQTV5M Кварцевый потолочный обогреватель

    Фото: amazon.com

    Типы электрических гаражных обогревателей

    Хотя все электрические гаражные обогреватели в основном работают одинаково, электрические обогреватели делятся на три основных типа: с принудительной вентиляцией, инфракрасные (лучистые) и керамические.

    С принудительным вентилятором

    Нагреватели с принудительным вентилятором используют электрический нагревательный элемент внутри нагревателя для быстрого нагрева воздуха вокруг него. Вентилятор в задней части обогревателя выталкивает этот горячий воздух в гараж или мастерскую, чтобы нагреть окружающий воздух и повысить температуру в помещении.Этот тип электрического обогревателя требует времени, чтобы нагреться, и не так эффективен, как керамический обогреватель. Так что, если у вас меньшее рабочее пространство и вы не против немного подождать немного тепла, обогреватель с принудительной вентиляцией сослужит вам хорошую службу; в противном случае вы можете рассмотреть инфракрасный или керамический электрический обогреватель для гаража.

    Инфракрасный

    Инфракрасный обогреватель гаража также известен как излучающий или кварцевый обогреватель. Они генерируют лучистое инфракрасное тепло, которое можно использовать как в небольших, так и в больших гаражных помещениях.Эти обогреватели начинают работать, как только вы их включаете, и обеспечивают очень высокую теплоемкость по сравнению с вентиляторными или керамическими электрическими гаражными обогревателями.

    Однако тепло, выделяемое инфракрасными обогревателями, не нагревает воздух в гаражном пространстве. Скорее, инфракрасный обогрев нагревает физические объекты, с которыми соприкасаются инфракрасные волны, такие как человек или транспортное средство. Это означает, что, хотя при включенном обогревателе вам будет тепло, температура окружающего воздуха не изменилась, а при выключении обогревателя температура предметов и людей в гараже быстро упадет.Это также означает, что чем больше предметов и людей у ​​вас в гараже, тем менее эффективным будет инфракрасный обогреватель, потому что волны будут распространяться по объектам и людям в комнате.

    Керамика

    Керамические электрические гаражные обогреватели работают в основном так же, как и обогреватели с принудительной подачей воздуха, но с одним существенным отличием: они используют керамический нагревательный элемент вместо металлического компонента в обогревателях с принудительной подачей воздуха. Эта разница в материалах делает их намного более эффективными, чем нагреватели с принудительным вентилятором, при обогреве большого помещения.Керамические обогреватели - хороший вариант для больших помещений, где вы хотите повысить температуру окружающего воздуха, а не нагревать только физические объекты, как в случае с инфракрасным обогревателем. Тем не менее, керамическим обогревателям для гаража потребуется некоторое время, чтобы нагреться, прежде чем вентилятор начнет выдувать теплый воздух.

    Что следует учитывать при выборе лучшего гаражного электрического обогревателя

    Перед тем, как выбрать электрический гаражный обогреватель для гаража или рабочего места, уделите несколько минут тому, чтобы узнать о наиболее важных моментах покупки, которые следует учитывать.

    Размер гаража

    Размер гаража является важным фактором при выборе электрического обогревателя для гаража. Если вы приобретете агрегат, который недостаточно мощный для помещения, которое вы хотите отапливать, вы останетесь работать на холоде и потеряете деньги, которые вы потратили на неправильный обогреватель. Хорошее правило, которому следует следовать при выборе подходящего обогревателя для гаража: на каждые 10 Вт выходной мощности вы можете обогреть 1 квадратный фут площади. Например, гараж или магазин площадью 150 квадратных футов будет полностью отапливаться гаражным электрическим обогревателем мощностью 1500 ватт.

    Также помните о фактическом объеме используемого пространства. Если вы используете только треть своего гаража, а остальная часть предназначена для вашего автомобиля или для хранения вещей, то вы можете получить обогреватель меньшего размера, который будет обеспечивать достаточно тепла для вас, но не будет тратить энергию на нагрев остальной части. незанятая комната.

    Переносные и навесные

    Гаражные электрические обогреватели можно разделить на два основных типа установки: переносные и навесные.

    • Переносные электрические обогреватели для гаража могут стоять на земле или на столе, и вы можете маневрировать ими где угодно и как угодно, чтобы получить максимальное тепло для помещения.Эти обогреватели не требуют особой установки или настройки и, как правило, нуждаются только в доступной розетке, чтобы начать работу прямо из коробки. Эти обогреватели занимают место на полу и на столе, и их шнур может быть опасен для спотыкания.
    • Навесные гаражные электрические обогреватели могут быть настенными или потолочными. Они также могут быть подключены к электрической системе здания для более мощного тепловыделения, или они могут быть включены в обычную розетку, что представляет собой тип навесного обогревателя, который легче установить, чем проводной тип.Навесные обогреватели - отличный вариант, если вы ищете полупостоянный обогреватель, который вам нужно будет установить только один раз. Однако, если у вас нет большого гаража или мастерской, эти более крупные агрегаты могут оказаться слишком мощными для небольшого пространства.

    Регулируемый термостат

    Если вам нужен электрический гаражный обогреватель, который может контролировать температуру окружающей среды в помещении и включаться при слишком низкой температуре и выключаться при слишком высокой температуре, тогда вам понадобится обогреватель с встроенный регулируемый термостат.Эта функция позволяет вам выбрать идеальную температуру для гаража, и обогреватель автоматически начнет нагреваться до тех пор, пока окружающий воздух в комнате не достигнет этой температуры. Эта функция идеальна в более холодном климате, где может потребоваться круглосуточное отопление, потому что функции автоматического включения и выключения будут поддерживать нужную температуру в вашем гараже, не тратя ненужную энергию.

    Техническое обслуживание

    Любое отопительное или охлаждающее устройство потребует определенного технического обслуживания, чтобы продолжать эффективно работать в течение многих лет, и электрический гаражный обогреватель не исключение.Легкие обогреватели дешевле, чем более прочные, но они не прослужат так долго. Так что, если вы не возражаете заменять обогреватель каждые пару лет, вы можете получить достаточно тепла, не прибегая к особому техническому обслуживанию.

    Более прочные электрические обогреватели для гаража прослужат дольше, но вам необходимо регулярно чистить их, проверять вводы питания на предмет обрывов и проверять тепловые мощности, чтобы убедиться, что они функционируют должным образом. Если вы будете делать это на регулярной основе, эти более дорогие обогреватели могут со временем обойтись дешевле, чем замена нескольких легких обогревателей.

    Функции безопасности

    Электрические обогреватели для гаражей могут быть опасными, если они не установлены, не настроены и не используются должным образом. К счастью, многие производители начали добавлять функции безопасности, призванные сделать продукт максимально защищенным от несчастных случаев, включая механизм опрокидывания, защиту от перегрева и функцию холодного прикосновения.

    • Механизмы опрокидывания были разработаны, потому что электрические обогреватели для гаража легко опрокинуть в загруженной мастерской, небольшом гараже или в доме с маленькими детьми.Этот механизм срабатывает при опрокидывании обогревателя и автоматически выключает обогреватель для предотвращения повреждений.
    • Защита от перегрева - полезная функция, которая есть у большинства электрических обогревателей. Он рассчитан на длительное использование в течение нескольких дней, когда температура окружающей среды может колебаться на несколько градусов, вызывая перегрев обогревателя. Когда это происходит, защита от перегрева определяет повышение температуры и отключает обогреватель, чтобы предотвратить внешнее повреждение вашего гаража и внутреннее повреждение обогревателя.
    • Элементы Cool-touch в основном используются для настенных и переносных гаражных обогревателей, поскольку они часто устанавливаются или устанавливаются в местах, где проходящие дети или взрослые могут соприкасаться с боковыми стенками обогревателя. Обогреватели без этой функции безопасности могут вызвать значительный ожог, но функция прохладного прикосновения позволяет дотронуться до внешней оболочки обогревателя или схватиться за нее, не повредив себя.

    Дополнительные функции

    Электрические обогреватели для гаража шагнули в ногу со временем и теперь имеют широкий спектр дополнительных функций, которые могут принести пользу вашему гаражу.Взгляните на эти функции ниже, чтобы узнать, являются ли они обязательными для вашего электрического обогревателя для гаража.

    • Удлиненные шнуры дают вам возможность разместить гаражный обогреватель в любом месте в пределах досягаемости от розетки, расширяя доступные области для установки и сохранения тепла.
    • Ручка на переносном обогревателе упрощает подъем и перемещение по гаражу, чтобы вы могли найти лучшее место для его установки.
    • Колеса могут повысить маневренность переносных обогревателей.
    • Жалюзи на электрическом гаражном обогревателе позволяют направлять поток тепла с помощью вентилятора или керамического гаражного обогревателя.
    • Электрические обогреватели для гаража с поддержкой Wi-Fi могут подключаться к веб-сайту или приложению, чтобы вы могли управлять обогревателем через свой телефон, пока подключен Wi-Fi.

    Наши фавориты

    Приведенные ниже продукты с наивысшим рейтингом были выбраны по качеству, цене и функциональности, чтобы помочь вам найти лучший электрический гаражный обогреватель для вашего гаража или мастерской.

    Фото: amazon.com

    Если у вас большой гараж, обогреватель Fahrenheat мощностью 5 000 Вт справится с задачей обогрева. В этой модели используется принудительный вентилятор для обогрева больших и сквозняков на рабочем месте. Обогреватель поставляется с монтажным кронштейном, который позволяет установить его на потолке или стене, в зависимости от того, куда вы хотите направить тепло. Нагреватель также оснащен регулируемыми жалюзи для лучшего контроля направления.

    Хотя вы будете платить более высокую цену за этот электрический гаражный обогреватель, вы получите пульт дистанционного управления для дистанционного управления, защиту от перегрева и регулируемый термостат, который будет отслеживать температуру окружающей среды и автоматически включать или выключать обогреватель в зависимости от к текущему чтению.Однако имейте в виду, что этот нагреватель необходимо либо подключить напрямую к системе на 208 или 240 вольт, либо подключить к розетке на 208 или 240 вольт с помощью соответствующей вилки.

    Фото: amazon.com

    Этот портативный электрический гаражный обогреватель имеет форму башни и имеет функцию колебаний, поэтому тепло может распределяться по более высокой и широкой площади от керамических элементов. Вы можете установить температуру либо на фиксированное низкое значение, либо на фиксированное высокое значение для максимальной выходной мощности 1500 Вт.Керамический обогреватель также оснащен регулируемым термостатом, который можно использовать для автоматического режима.

    Когда вы включаете обогреватель, вы можете установить автоматический таймер, который выключит обогреватель, когда он достигнет запланированного времени, или вы можете оставить его работать самостоятельно, пока вы его не выключите. Обогреватель поставляется со встроенной ручкой для переноски, пультом дистанционного управления и несколькими функциями безопасности, включая защиту от перегрева и приятный на ощупь внешний вид, который позволяет вам маневрировать обогревателем во время его использования, не обжигаясь.

    Фото: amazon.com

    Aikoper - хороший выбор, если вы не хотите заниматься монтажом проводки или установкой обогревателя. Просто подключите шнур к ближайшей стандартной розетке и установите температуру на регулируемом цифровом термостате, чтобы начать нагревать гараж до желаемой температуры. При низком нагреве выделяется 900 Вт энергии, при сильном нагреве - до 1500 Вт.

    ЭКО-режим автоматически выключит или включит обогреватель по мере необходимости в соответствии с вашими настройками температуры, поэтому вы никогда не останетесь без тепла, но вы не тратите энергию, когда обогреватель не нужно включать.Этот керамический обогреватель имеет колебательную функцию для более широкого распределения тепла и дистанционное управление. Не допускающий охлаждения корпус нагревателя и встроенные ручки делают его идеальным вариантом для переноски, а нагреватель также имеет защиту от перегрева и опрокидывания для дополнительной безопасности.

    Фото: amazon.com

    Для настенного гаражного электрического обогревателя предлагает впечатляющий Broan-NuTone. Настенный обогреватель предназначен для работы с электрической системой на 240 В (максимальная выходная мощность 4000 Вт) или 120 В (максимальная выходная мощность 2000 Вт), и его можно либо подключить к доступной розетке, либо подключить напрямую к электрической сети. системы, если у вас есть соответствующие насадки.

    Гаражный электрический обогреватель с вентилятором имеет усиленную стальную решетку 18-го калибра и регулируемый термостат, расположенный на передней панели обогревателя. Жалюзи нисходящего потока в решетке направляют воздушный поток к земле, поэтому лучше всего установить обогреватель выше на стене. Встроенная задержка вентилятора предотвращает работу вентилятора до тех пор, пока элемент не достигнет достаточно высокой температуры, поэтому вентилятор будет выталкивать только нагретый воздух.

    Фото: amazon.com

    Этот потолочный обогреватель имеет гладкий, компактный дизайн и поставляется с монтажным кронштейном для крепления обогревателя к потолку.Оттуда его можно наклонять до 90 градусов, чтобы лучше контролировать направление тепла.

    В инфракрасном электрическом гаражном обогревателе используются две излучающие кварцевые лампы для отражения инфракрасного тепла в комнату и любые находящиеся поблизости предметы или людей. Обогреватель оснащен галогенной лампой (включая лампочку) для лучшей видимости в мастерской, а также имеет датчик перегрева, который автоматически отключает обогреватель, если он начинает перегреваться. Хотя у него нет защиты от холодного прикосновения, у него есть металлическая защитная сетка, которая предотвращает соприкосновение мощных кварцевых ламп с чем-либо еще.

    Преимущества владения гаражным электрическим обогревателем

    Есть много преимуществ владения гаражным электрическим обогревателем, но одно из главных преимуществ этих полезных приборов - это возможность иметь теплое и удобное рабочее место в гараже круглый год.

    Электрические обогреватели для гаражей по сравнению со встроенными системами отопления также дают вам возможность выбирать, как и где их использовать, при условии, что у вас есть доступный источник питания. Установите полупостоянный обогреватель на стену или потолок гаража, если вы предпочитаете надежный источник тепла, который вам не нужно настраивать каждый раз, когда вы его используете.Если вам нужна большая маневренность электрического гаражного обогревателя, вы можете приобрести портативный продукт, которому нужна только розетка и место для установки.

    Простая установка и экологичная эксплуатация - два основных преимущества электрических гаражных обогревателей по сравнению с газовыми обогревателями. Электрические обогреватели также более доступны по цене, а их тепловая мощность оптимальна для большинства жилых гаражей, хотя для очень больших помещений может потребоваться более мощный вариант обогрева, такой как газовый обогреватель.

    • Использование гаражного электрического обогревателя позволяет эффективно работать в гараже при низких температурах.
    • Электрические гаражные обогреватели могут быть закреплены на потолке или стене в полупостоянном положении или могут быть переносными, что дает вам свободу выбора, где и как их использовать.
    • Для жилых гаражей электрический обогреватель - недорогой и эффективный вариант, который проще в установке по сравнению с гаражными обогревателями, работающими на природном газе.

    Часто задаваемые вопросы о вашем новом электрическом гаражном обогревателе

    Ниже приведены некоторые ответы на часто задаваемые вопросы об электрических гаражных обогревателях.

    В. Где мне разместить обогреватель для гаража?

    Переносные гаражные электрические обогреватели можно разместить где угодно. Если они не дают вам желаемого результата и тепла, просто переместите их. Стационарные или навесные электрические обогреватели для гаража с функцией приточного или керамического обогрева должны быть установлены в самом холодном углу гаража с направлением воздуха в центр комнаты.

    Стационарные или навесные электрические обогреватели для гаража, использующие инфракрасное или лучистое отопление, должны располагаться на расстоянии не менее 24 дюймов от стен гаража, чтобы гарантировать, что они не вызовут пожар.Измерьте и отметьте эту зону безопасности, а затем выберите область в пределах зоны, близкую к вашему обычному рабочему пространству, чтобы вы могли извлечь максимальную пользу от обогревателя, когда он будет установлен.

    В. Сколько ватт мне нужно для обогрева гаража?

    Тип обогревателя, планировка вашего гаража, содержимое вашего гаража и температура окружающей среды - все это факторы, которые могут затруднить точное измерение, но основное правило, которому следует следовать, составляет примерно 10 Вт на каждый квадрат. фут пространства, которое вы хотите обогреть.

    В. Сколько стоит использовать гаражный электрический обогреватель?

    Это сильно зависит от ваших местных затрат на электроэнергию, мощности электронагревателя и того, как долго он использовался. Однако в среднем электрический обогреватель мощностью 1500 Вт будет стоить от 0,18 до 0,25 доллара в час.

    Настраиваемый и точный миниатюрный литиевый нагреватель для применения в местах оказания медицинской помощи

    Значимость

    Биохимические методы необходимы для различных применений в местах оказания медицинской помощи, от диагностики заболеваний до производства вакцин.Многие из этих приложений нельзя использовать в удаленных местах из-за того, что они полагаются на электричество для регулирования температуры. Здесь мы разработали миниатюрный литиевый обогреватель, который в 8000 раз меньше, чем существующие технологии, что позволяет использовать биохимические методы при оказании медицинской помощи. Используя эти нагреватели в модельном рабочем процессе, который обнаруживает присутствие вируса, мы демонстрируем их применимость к широкому спектру биохимических методов, требующих точного контроля температуры. Эта технология может широко использоваться, например, в лагерях помощи при стихийных бедствиях или в горных экспедициях, для диагностических и терапевтических целей.

    Abstract

    Диагностические анализы на месте оказания помощи часто включают многоэтапные реакции, требующие широкого диапазона точных температур. Хотя точный нагрев имеет решающее значение для выполнения этих анализов, сложно обеспечить его в формате без электричества вдали от установленной инфраструктуры. Химические нагреватели не требуют электричества и используют экзотермические реакции. Однако они не подходят для многоэтапных реакций в месте оказания медицинской помощи, поскольку жертвуют портативностью, имеют узкий диапазон достижимых температур и длительное время нарастания.Здесь мы разработали миниатюрный нагреватель, модулируя кинетику реакции лития с водой с помощью пузырьков в канале. Наши нагреватели в 8000 раз меньше, чем существующие устройства, и могут обеспечить точный (в пределах 5 ° C) и настраиваемый нагрев от 37 ° C до 65 ° C (∆T RT = от 12 ° C до 40 ° C) с линейным изменением температуры. раз в минуту. Мы демонстрируем мобильность и стабильность в полевых условиях и демонстрируем их использование в многоступенчатом рабочем процессе без использования электричества, который требует диапазона температур. В конечном итоге мы планируем обеспечить лучший доступ к передовым биохимическим методам, включая диагностику, за счет предоставления портативного и бесплатного обогрева в любом месте.

    Диагностические анализы в местах оказания помощи часто включают сложные многоступенчатые реакции, требующие широкого диапазона температур для этапов, начиная от обработки образцов и заканчивая генетическим анализом (1–3). Хотя точное нагревание имеет решающее значение для проведения этих анализов, его сложно обеспечить в полевых условиях вдали от установленной инфраструктуры. Существующие методы, обеспечивающие точный нагрев, такие как термоциклеры, часто зависят от электричества. Однако темпы электрификации в странах с ограниченными ресурсами могут составлять всего 10%, а перебои в подаче электроэнергии могут оставлять потребителей без доступа к электричеству более чем на 50% часов в год (4, 5).Чтобы обеспечить диагностику в местах оказания медицинской помощи в таких областях, крайне важно свести к минимуму зависимость от инфраструктуры и электричества (6, 7).

    Химические нагреватели - это безэлектричество решение для обеспечения точного нагрева для диагностических анализов. Как правило, в этих нагревателях используется экзотермическая реакция в сочетании с материалом с фазовым переходом (PCM) и изоляцией для достижения требуемой температуры (8⇓⇓⇓⇓ – 13). Однако эти нагреватели не подходят для проведения многоэтапных реакций в месте оказания медицинской помощи.Они приносят в жертву портативность, имеют узкие диапазоны достижимых температур и длительное время разгона, что увеличивает общее время выполнения работ. В то время как одна температура полезна для использования определенного фермента, ферментативные реакции, которые используются диагностическими анализами, охватывают диапазон температур (14): от эндонуклеаз рестрикции, таких как EcoR I, оптимально работающих при 37 ° C (15), до Bst ДНК-полимеразы, выполняющей оптимально при 65 ° C (16). Поэтому эти химические нагреватели либо ограничены одностадийными анализами, для которых требуется только одна температура, либо требуют нескольких химических нагревателей, настроенных на каждую требуемую температуру.Однако использование нескольких нагревателей является сложной задачей, учитывая их размер (9, 17) (до 4400 см 3 ) и время разгона (8) (от 5 до 30 минут). Чтобы использовать химические нагреватели для точного нагрева без использования электричества, необходимо уменьшить общий размер и повысить гибкость: как с точки зрения времени выполнения работ, так и с точки зрения достижимых температур. Здесь мы разработали миниатюрный нагреватель до 8000 раз меньшего размера, использующий движение пузырьков лития и водорода в трубках различной формы.

    Наш нагреватель использует взаимодействие между активной химической реакцией и пассивным пузырьковым потоком, чтобы использовать энергию непредсказуемого и реактивного щелочного металла. Литий был выбран в качестве источника топлива для нагревателя из-за его высокой плотности энергии (∼222 кДж / моль), простоты пластичности и простой активации водой (18). Податливая природа лития позволяет легко контролировать форму и площадь поверхности щелочного металла, обеспечивая предсказуемый нагрев. Это позволило нам сжать литий в канал, где могла происходить реакция лития с водой, и действовать как нагреватель.Кроме того, канал обеспечивает замкнутое пространство, где водные реагенты и газообразные продукты конкурируют за место внутри системы. Мы использовали объем исследований движения пузырьков в удлиненных трубках (19⇓ – 21) для управления взаимодействием между реагентами для разработки воспроизводимых и точных миниатюрных нагревателей. Управляя высокой удельной энергией, обеспечиваемой литием, мы смогли разработать нагреватель, идеально подходящий для оказания медицинской помощи. Эта разработка может ускорить перевод сложных биологических анализов в пункт оказания медицинской помощи, а его применимость распространяется на биологические приложения, такие как редактирование генов (22) или синтез белка (23, 24).

    Результаты

    Разработка миниатюрных литиевых нагревателей.

    Для обеспечения портативного обогрева без использования электричества в месте оказания помощи мы разработали миниатюрный обогреватель, который может поместиться на кончике пальца за счет экзотермической реакции лития и воды. Мы контролировали температуру внутри нагревателя, модулируя взаимодействия между реагентами, литием и водой, и продуктами, пузырьками водорода и гидроксидом лития (рис. 1 A ). Эта модуляция была достигнута путем управления границей раздела между двумя реагентами для нагрева и хранения.Во-первых, чтобы управлять этим интерфейсом для нагрева, мы заполнили акриловый канал литием. В частности, мы регулировали доступ лития к воде и контролировали удаление пузырьков водорода, изменяя размер и форму канала, а также поверхностное натяжение воды. Затем мы контролировали границу раздела между литием и водяным паром в воздухе для хранения, добавляя защитный барьер. Поскольку литий очень реактивен с влагой в воздухе (18), мы хотели обеспечить воспроизводимость наших нагревателей даже после транспортировки и хранения.Мы контролировали взаимодействие лития с водяным паром, добавляя растворимую смесь вспомогательных веществ, которая включала минеральное масло (25) и маннит (26, 27) в качестве барьера для защиты. Наш миниатюрный нагреватель состоит из системы, состоящей из двух частей: 1) заполненного литием акрилового канала и 2) растворимой смеси минерального масла и маннита (рис. 1 B и C ). Мы изготовили эту систему, используя рабочий процесс, в котором использовались технологии лазерной резки, а также ручное сжатие. Сначала мы вырезаем лазером акриловые каналы разных размеров и форм.За этим последовало прессование лития в вырезанные лазером акриловые формы. Мы визуально осмотрели нагреватели, чтобы убедиться, что литий полностью сжат до краев канала ( SI Приложение , рис. S1). Затем мы заклеили один конец форм с литием акриловой листовой основой. Наконец, мы снабдили другой конец кольцевой формой, в которую мы добавили минеральное масло, маннит и другие вспомогательные вещества. После разработки мы можем использовать нагреватели, поместив их в 1-3 мл воды, которая действует как реагент и как теплоноситель для нагрева реакционных трубок (рис.1 D ). Мы выбрали акрил в качестве корпуса для лития из-за его низкого коэффициента теплового расширения 75 × 10 −6 м / м / К, чтобы минимизировать влияние тепла на размеры и морфологию канала ( SI Приложение , Таблица S1). Мы можем кодировать нагреватели цветом или изменять форму и размер акриловой формы, чтобы повысить удобство использования для выполнения многоступенчатого анализа, требующего нескольких нагревателей (рис. 1 C ). Здесь мы демонстрируем разработку миниатюрного нагревателя с использованием движения удлиненных пузырьков в трубках разной формы для предсказуемого использования энергии щелочного металла с высокой плотностью энергии.Разработав безэлектричество обогреватель, который может поместиться на кончике пальца, мы разработали платформу, не зависящую от инфраструктуры, которая отличается высокой портативностью, простотой транспортировки и обращения.

    Рис. 1.

    Разработка миниатюрных литиевых нагревателей. ( A ) Схема, изображающая экзотермическую реакцию между литием и водой в миниатюрном нагревателе. Нагреватели предназначены для контроля взаимодействия между реагентами и продуктами реакции лития с водой. ( B ) Миниатюрные литиевые нагреватели состоят из двух частей: 1) заполненной литием акриловой формы и 2) растворимой смеси порошков.( C ) Фотография миниатюрного обогревателя. Обогреватели могут быть изготовлены в различных конфигурациях, при этом они имеют достаточно малую площадь основания, чтобы поместиться на кончике пальца. (Масштабная линейка, 8 мм.) ( D ) Нагреватели разрабатываются путем первой лазерной резки акриловых форм с последующим сжатием лития и герметизацией одной стороны нагревателя. В эту конструкцию сверху нагревателя добавляются стабилизирующие вспомогательные вещества. Миниатюрные нагреватели можно использовать для нагрева реакционных трубок, помещенных в небольшие объемы воды.

    Обеспечение точной и настраиваемой температуры.

    Мы хотели разработать нагреватель, который может обеспечивать температуру в диапазоне от 37 ° C до 65 ° C (∆T RT = от 12 ° C до 40 ° C) с точностью до 5 ° C. Мы выбрали эти критерии дизайна на основе того, что обычно требуется для оптимального выполнения ферментативного анализа ( SI Приложение , Таблица S2). Точный и регулируемый нагрев был достигнут за счет изменения формы и площади поверхности акриловых каналов нагревателя соответственно.Мы использовали более простую версию миниатюрного нагревателя, чтобы систематически определять влияние формы и площади поверхности на точность и возможность настройки температуры. В этой версии был только один компонент: акриловая форма, заполненная литием (рис. 2 A ). Во-первых, мы продемонстрируем точный нагрев, изменив форму акрилового канала. Форма канала была оптимизирована, чтобы увеличить удаление пузырьков водорода из канала для улучшения взаимодействия между реагентами, литием и водой.Мы разработали литиевые акриловые формы с круглыми, квадратными, треугольными и звездообразными каналами с фиксированной площадью поверхности (Рис. 2 B и C и SI Приложение , Рис. S2). Затем эти формы помещали в кювету, содержащую 1 мл воды, и пробирку с содержимым, которое необходимо нагреть. Температура трубки контролировалась с помощью тепловизионной камеры, а образование пузырьков водорода - с помощью видеокамеры ( SI Приложение , рис. S3). Каналы с более острыми и более многочисленными углами обеспечивали более воспроизводимые температурные профили и конечные температуры ( SI Приложение , рис.S2). Круглые каналы обеспечивали наиболее неравномерный нагрев, в то время как звездообразные каналы обеспечивали наиболее точные и воспроизводимые температурные профили (рис. 2 B и C ). Это несоответствие наблюдалось из-за отсутствия зазора газообразного водорода из круглых каналов, которые образовывали пузыри Тейлора (28, 29) или удлиненные пузырьки водорода, в несколько раз превышающие диаметр канала. В этом масштабе силы поверхностного натяжения преобладают над силами плавучести, что непредсказуемо препятствует увеличению скорости пузырька (28, 30).Когда каналы заблокированы более медленно движущимися пузырьками Тейлора, меньше воды может получить доступ к литию, чтобы обеспечить непрерывный нагрев. И наоборот, в канале в форме звезды более острые углы приводили к задержке большего количества воды в углах (рис. 2 D ). При повышенном удерживании воды в углах больше воды может двигаться вниз и получать доступ к литию, при этом обеспечивая удаление пузырьков водорода (19). Это позволяет протекать реакции, обеспечивая непрерывное образование пузырьков водорода и точность нагрева.Поэтому мы использовали точность, обеспечиваемую звездообразными каналами, для дальнейшего создания платформы для обеспечения регулируемой температуры.

    Рис. 2.

    Влияние формы и площади поверхности на точность и настраиваемость миниатюрных нагревателей. ( A ) Критерии проектирования миниатюрного обогревателя. Мы хотим, чтобы нагреватель имел погрешность в пределах 5 ° C и достигал настраиваемой температуры в диапазоне от 37 ° C до 65 ° C (∆T RT = от 12 ° C до 40 ° C). ( B ) Фотографии миниатюрных обогревателей со звездообразными vs.круглые внутренние каналы в воде. Звездообразные внутренние каналы непрерывно нагревают воду, очищая пузырьки водорода, в то время как круглые каналы приводят к неравномерному нагреву из-за отсутствия зазора между пузырьками водорода. Масштаб утеплителя: 8 мм. ( C ) Температурный профиль звездообразных миниатюрных нагревателей с круглыми каналами ( n = 3). Каналы в форме звезды обеспечивают точный нагрев (<5 ° C), в то время как круглые каналы обеспечивают неравномерный нагрев (> 5 ° C). ( D ) Механизм роли формы при точном нагреве.Каналы с более острым углом могут удерживать больше воды под своими углами и обеспечивать доступ к воде, несмотря на образование пузырьков водорода. ( E ) Влияние площади поверхности канала на настраиваемость температуры ( n = 3). Изменяя площадь поверхности доступа лития к воде, можно регулировать конечную температуру. ( F ) Механизм влияния площади поверхности на конечные температуры. Большая площадь поверхности обеспечивает доступ к воде большего количества лития, что приводит к более высоким конечным температурам.SA Li = площадь поверхности лития; m Li = масса лития; T F = конечная температура.

    Чтобы обеспечить возможность настройки температуры, мы варьировали площадь поверхности отверстий каналов. Это позволило нам варьировать количество воды, имеющей доступ к литию. Площадь поверхности звездообразного канала от 0,75 мм 2 до 6 мм 2 (от ∼1 до 10 мг) обеспечивала диапазон температур от ∼40 ° C до ∼100 ° C (∆T RT = ∼ От 20 ° C до 70 ° C) (Рис.2 E ).Здесь мы использовали площадь поверхности как рычаг для изменения общей массы лития в канале, где большие площади поверхности обеспечивали большее воздействие воды на литий. Учитывая высокую скорость нагрева миниатюрных нагревателей, общая масса лития определяла конечную температуру раствора (рис. 2 F ). Таким образом, площадь поверхности отверстий каналов использовалась в качестве косвенного физического параметра для настройки конечной температуры раствора. В дополнение к изменению площади поверхности канала, также можно обеспечить возможность регулировки температуры путем изменения объема воды, в которую погружен нагреватель ( SI Приложение , рис.S4). Однако динамический диапазон, обеспечиваемый этим методом, не так велик для данного контейнера. Мы обеспечили точный и широкий диапазон температур, изменив как форму, так и площадь поверхности акрилового канала нагревателя.

    Увеличение времени удержания миниатюрного нагревателя.

    Мы хотели, чтобы миниатюрный нагреватель поддерживал диапазон температур с точностью до 5 ° C в течение 10–15 минут (рис. 3 A ). По данным Всемирной организации здравоохранения (ВОЗ), одним из критериев идеального теста является то, что он будет быстрым и надежным и может быть выполнен в течение 30 минут (31).Поскольку эти испытания состоят из нескольких этапов и требуют разных температур, каждый этап может потребовать поддержания определенной температуры в течение 10–15 минут. Чтобы увеличить время выдержки, мы изменили поверхностное натяжение раствора, чтобы уменьшить скорость удаления пузырьков водорода. Уменьшая скорость удаления пузырьков водорода, мы смогли уменьшить скорость нагрева, чтобы продлить и поддерживать заданную температуру в минутной шкале. Примерно 70% тепла, выделяемого нагревателем, передается образцу без использования какой-либо изоляции ( SI Приложение , рис.S5 и S6). Чтобы иметь время выдержки в минутной шкале, мы использовали два нагревателя: один с высокой скоростью нагрева, а другой с меньшей скоростью нагрева (рис. 3 A ). Первый нагреватель будет быстро доводить раствор до заданной температуры, а второй будет поддерживать температуру в течение нескольких минут. Для создания нагревателя с более низкой скоростью нагрева поверхностное натяжение раствора, в который был погружен нагреватель, варьировали, добавляя различные количества поверхностно-активного вещества, додецилсульфата натрия (ДСН) (32, 33).Однако при добавлении поверхностно-активного вещества мы наблюдали снижение максимальной температуры, достигаемой при каждом последующем добавлении нагревателей. Мы предполагаем, что это уменьшение нагрева происходит из-за снижения скорости реакции за счет накопления побочного продукта гидроксида лития (LiOH) ( SI Приложение , рис. S7). Поэтому мы использовали максимальный объем 3 мл для экспериментов, которые требуют минутного времени удержания для минимизации насыщения. При таком объеме конечная температура нагревателей с высокой скоростью нагрева была ниже, чем при использовании 1 мл раствора ( SI Приложение , рис.S8). Для простоты вместо использования миниатюрного нагревателя с высокой скоростью нагрева для доведения раствора до заданной температуры мы нагрели раствор до 55 ° C (∆T RT = 30 ° C). Затем мы добавили нагреватель с низкой скоростью нагрева вместе с SDS и пеногасителем, чтобы минимизировать пенообразование (34) (рис. 3 B ). В 1% растворе SDS температуру раствора поддерживали постоянной (± 2,5 ° C) в течение 10 мин. Ниже 1% SDS время выдержки было короче 10 мин, в то время как выше 1% SDS скорость нагрева была слишком низкой для поддержания температуры в пределах ± 2.5 ° C (Рис. 3 B и SI Приложение , Рис. S9). Это явление обеспечения более низких скоростей нагрева происходит в результате взаимодействия между поверхностным натяжением и размером пузырьков водорода. При добавлении ПАВ поверхностное натяжение раствора уменьшается (32). В растворе с более низким поверхностным натяжением образуются пузырьки водорода меньшего размера (35), что приводит к более медленному движению вверх (36), большей плотности упаковки пузырьков и уменьшенному зазору пузырьков (рис. 3 C ).Это, в свою очередь, снижает скорость доступа воды к литию для потребления, тем самым уменьшая скорость нагрева. Чтобы еще больше увеличить время удержания, мы можем увеличить глубину акрилового канала. При постоянной скорости нагрева глубина канала определяет количество лития, доступного для потребления (рис. 3 E ). Мы показываем, что существует пропорциональность между глубиной канала и временем удержания при фиксированной концентрации SDS и площадью поверхности канала (Рис.3 F и SI Приложение , Рис.S10). Наконец, мы хотели продемонстрировать, что при оптимальной концентрации SDS 1% мы можем изменять температуру раствора в минутной шкале. Мы варьировали площадь поверхности отверстий акриловых каналов, чтобы получить диапазон температур, который поддерживался в течение ~ 10 мин (рис. 3 D ). Здесь мы показываем, что мы можем увеличить время удержания нагревателя, добавляя поверхностно-активное вещество в раствор и варьируя глубину акрилового канала.

    Рис. 3.

    Факторы, определяющие время удержания миниатюрного нагревателя.( A ) Требования к конструкции для увеличения времени удержания нагревателя. Два нагревателя были использованы для увеличения времени удержания нагревателя до 10-15 мин с точностью 5 ° C. ( B ) Влияние концентрации поверхностно-активного вещества на время выдержки ( n = 3). Кюветы с 0% или 1% SDS нагревали до 55 ° C (∆T RT = 30 ° C) перед добавлением 3-мм звездообразного миниатюрного нагревателя 2 . Время выдержки определяется как время, в течение которого температура поддерживается в пределах 5 ° C.( C ) Механизм увеличения времени удержания поверхностно-активного вещества. Введение SDS уменьшает общий размер пузырьков, при этом более мелкие пузырьки водорода поднимаются медленнее и требуется больше времени, чтобы покинуть канал, что приводит к более медленным скоростям нагрева. ( D ) Глубина канала как рычаг для регулирования времени удержания. При более медленных скоростях нагрева глубина канала модулирует доступный литий для потребления, где масса лития прямо пропорциональна продолжительности времени выдержки. ( E ) Влияние глубины акрилового канала на время удержания ( n = 3).Глубину канала можно увеличить, чтобы увеличить время удержания. Статистическая значимость была рассчитана с помощью теста t (**** = <0,0001). ( F ) Влияние площади поверхности на возможность настройки конечных температур в 10-минутном масштабе времени ( n = 3).

    Использование миниатюрных литиевых нагревателей в условиях ограниченных ресурсов.

    Мы проверили, насколько хорошо обогреватели работают в очень влажной среде, где производительность обогревателей может быть резко снижена, чтобы смоделировать настройки с ограниченной инфраструктурой.Затем мы проверили, насколько хорошо нагреватели доставляют реагенты, обеспечивая при этом безопасное обращение, чтобы моделировать их использование операторами с ограниченным обучением. Мы проверили удобство использования миниатюрных обогревателей, сначала разработав полную версию платформы. Полная версия миниатюрного нагревателя включает добавление стабилизирующих наполнителей в акриловую форму, заполненную литием. К форме, заполненной литием, устанавливали кольцевую акриловую форму и добавляли минеральное масло, маннит и SDS (рис. 4 A ).Во-первых, чтобы проверить работу нагревателей в условиях высокой влажности, мы поддерживали нагреватели с наполнителями и без них при относительной влажности (RH) 20% и 70% в течение 4 недель. Конечная температура, достигнутая в каждый момент времени, когда нагреватель был погружен в воду, использовалась в качестве метрики для определения стабильности. В присутствии вспомогательных веществ нагреватели достигали ∼55 ° C (∆T RT = 30 ° C) в течение 4 недель, в то время как в отсутствие вспомогательных веществ пиковые температуры резко снижались при 20% и 70% относительной влажности (Рис. .4 В ). Несмешиваемая природа минерального масла (25) и негигроскопичность маннита ограничивают взаимодействие лития с влагой воздуха, тем самым обеспечивая стабильность. Миниатюрные обогреватели одинаково хорошо работают в условиях ограниченной инфраструктуры с недостаточной контролируемой влажностью.

    Рис. 4.

    Демонстрация удобства использования миниатюрного литиевого нагревателя. ( A ) Процесс добавления растворимой смеси порошков и минерального масла. После того, как литий спрессован в форму и запечатан с одного конца, удерживающее кольцо приваривается ацетоном к другому концу.В это кольцо добавляют 10 мкл минерального масла, а затем необходимое количество SDS и маннита. ( B ) Стабильность нагревателя при относительной влажности 20% и 70% по сравнению с чистым литием ( n = 3). Обогреватели сохраняют работоспособность в течение 4 недель, не требуя дополнительной упаковки. ( C ) Сравнение доставки точных количеств SDS с помощью пипеток и миниатюрного нагревателя ( n = 3). Тест t был проведен для определения статистической значимости (N.S., статистически недостоверно).( D ) Моделирование разлива при сравнении чистого лития с миниатюрным нагревателем ( n = 1). Характерный профиль чистого лития, когда он достигает высоких температур за считанные секунды, по сравнению с миниатюрным нагревателем, который занимает более 6 минут, что дает достаточно времени для реакции на разлив.

    Далее мы продемонстрируем, что обогреватели можно использовать даже при ограниченном обучении. Сначала мы покажем, что миниатюрные нагреватели могут доставлять точное количество SDS, чтобы минимизировать общее количество этапов обработки (рис.4 С ). Мы показываем, что количество, доставляемое обученными пользователями, по точности сопоставимо с количеством, доставляемым нагревателем. Наконец, мы показываем, что литиевые нагреватели безопасны в обращении. Мы смоделировали разлив, добавив воды к эквивалентному количеству чистого лития и лития в нагревателе. Чистый литий достиг температуры ∼80 ° C (∆T RT = 55 ° C) за считанные секунды, в то время как литиевые нагреватели достигли температуры ∼44 ° C (∼∆T RT = 20 ° C), температура, при которой происходит ожог кожи, через ∼6 мин при отсутствии возбуждения (рис.4 D ). Используя обогреватель, конечный пользователь имеет больше времени, чтобы отреагировать на разлив и предотвратить опасные ожоги. Использование миниатюрных обогревателей не требует длительного обучения.

    Демонстрация полезности литиевых нагревателей в диагностическом анализе.

    Мы демонстрируем использование литиевых нагревателей для проведения общей диагностики. Мы показываем возможность использования нагревателей в многоступенчатых анализах, требующих различных температур ( SI Приложение , рис.S11). Мы использовали бактериофаг Т4 в качестве модельной системы для моделирования клинического образца. Мы лизировали бактериофаг при нагревании при 95 ° C (ΔT RT = 70 ° C), затем амплифицировали ДНК при 42 ° C (ΔT RT = 17 ° C) с использованием амплификации рекомбиназной полимеразы (RPA) и визуализировали ДНК с помощью флуоресцентного анализа при 42 ° C (∆T RT = 17 ° C) (фиг. 5 A ). Для лизиса использовали звездообразный нагреватель 2 диаметром 6 мм в 0,05% растворе SDS (рис. 5 B ). Образец бактериофага выдерживали при 95 ° C (∆T RT = 70 ° C) в течение ∼20 с ( SI Приложение , рис.S12). Затем мы амплифицировали лизированную ДНК с помощью RPA. В RPA белки рекомбиназы образуют ядерно-белковый комплекс с праймерами и сканируют гомологичные сайты на целевой ДНК (37). После обнаружения праймеры связываются с мишенью, и полимераза с обменом цепей экспоненциально амплифицирует ДНК. Для проведения RPA мы довели температуру раствора до ∼44 ° C (∆T RT = ∼19 ° C) с помощью нагревателя 4 мм 2 , затем поддерживали температуру 42 ° C (∆T RT = 55 ° C) в течение 10 минут с использованием 1.5 мм 2 звездообразный нагреватель на 1% растворе SDS (Рис. 5 B и SI Приложение , Рис. S13). После амплификации мы визуализировали целевую ДНК с помощью флуоресцентного анализа (38). Мы использовали парные зонды флуорофор-гаситель для первой гибридизации с амплифицированной ДНК. Затем мы использовали экзонуклеазу III для расщепления гибрида зонд-ДНК. Расщепление зонда приводит к флуоресценции, поскольку флуорофор отделяется от гасителя (рис. 5 A ). Для проведения флуоресцентного анализа мы сначала использовали 6-мм нагреватель 2 , чтобы довести температуру до 95 ° C для денатурирования амплифицированной ДНК (рис.5 В ). Мы дали раствору остыть до комнатной температуры, чтобы зонды гибридизировались с амплифицированной ДНК. Мы вводили экзонуклеазу в реакцию и позволяли реакции инкубироваться при 42 ° C (ΔT RT = 55 ° C), добавляя звездообразный нагреватель 4 мм 2 , а затем 1,5 мм 2 . Реакции давали возможность протекать в течение 10 мин. Флуоресценцию визуализировали с помощью камеры смартфона и фонарика в сочетании с фильтром возбуждения и излучения. Нам удалось успешно обнаружить ДНК бактериофага Т4, используя этот рабочий процесс с миниатюрными нагревателями (рис.5 C и SI Приложение , Рис. S14).

    Рис. 5.

    Использование миниатюрных обогревателей в диагностическом процессе. ( A ) Схема рабочего процесса диагностики. ( A ) Рабочий процесс включает выделение ДНК из бактериофага Т4, амплификацию с помощью RPA и флуоресцентное обнаружение амплифицированной ДНК с помощью смартфона. ( B ) Схема, показывающая комбинацию нагревателей, необходимых для достижения каждой температуры. Пошаговая температурная кривая показывает различные температуры, необходимые для выполнения каждого шага.( C ) Окончательные флуоресцентные результаты анализа ( n = 3). Репрезентативные изображения положительного и отрицательного результата показаны выше. Каждый повтор анализировали для определения средней интенсивности с помощью ImageJ. LOD, предел обнаружения. * P = 0,0194.

    Обсуждение

    Мы разработали воспроизводимую, стабильную и безопасную платформу для точного нагрева биологических тестов без использования электричества. Мы разработали каждое устройство, чтобы оно было достаточно маленьким, чтобы поместиться на кончике пальца, контролируя взаимодействие между литием и движением вытянутых пузырьков в трубках во время экзотермической реакции лития с водой.Каждое устройство изготавливается путем сжатия лития в различные акриловые каналы и герметизации смесью порошков и минерального масла при сохранении общего размера менее 0,5 см. 3 . Такой подход позволяет миниатюрным нагревателям не использовать электричество и достигать заданной температуры за 1 минуту, оставаясь при этом точным (5 ° C) и настраиваемым в диапазоне биологических анализов (∆T RT = от 12 ° C до 40 ° C). Благодаря небольшим размерам, работе без электричества, короткому времени нарастания, точности и возможности настройки, эту платформу можно использовать на месте для выполнения биологических анализов со сложными температурными требованиями.Путем введения поверхностно-активного вещества в реакционную смесь время выдержки может составлять> 20 мин. Поэтому мы расширяем применение миниатюрных нагревателей для ряда биологических анализов. Чтобы полностью реализовать потенциал платформы для различных сред с низким уровнем ресурсов на месте оказания помощи, мы показываем стабильность нагревателей при 20% и 70% относительной влажности в течение 1 мес. Это устраняет типичные барьеры, связанные с контролем окружающей среды и хранением в холодовой цепи, которые встречаются в условиях ограниченных ресурсов.

    Миниатюрные литиевые нагреватели имеют преимущество перед существующими технологиями по четырем основным причинам: 1) их размер, 2) гибкость в модуляции температуры, 3) быстрое время нарастания и 4) доступность.Во-первых, размер миниатюрного обогревателя упрощает транспортировку и обращение. Примерно 480 миниатюрных нагревателей можно упаковать в обычную кофейную чашку объемом 12 унций, что делает ее очень портативной и простой для проведения сложных биологических процедур в условиях отсутствия электричества. Типичные PCM могут быть от 10 до 9 000 раз больше (8⇓ – 10, 12, 17), что делает их менее гибкими для использования в местах оказания медицинской помощи. Во-вторых, гибкость настройки температуры позволяет платформе не зависеть от конечного варианта использования анализа, когда различные наборы ферментов больше не ингибируются из-за отсутствия инфраструктуры нагрева.В обычных химических нагревателях часто используются PCM, что затрудняет изменение температуры реакции для разных этапов анализа, так как это может потребовать изменения конструкции устройства (12). Получение нескольких специфических и нетрадиционных температур реакции в одном анализе также может оказаться трудным, поскольку вы будете необходимо носить с собой несколько модулей PCM и связанных с ними громоздких устройств. Это связано с тем, что PCM полагается на специфические свойства материала, что приводит к узким температурным границам каждой комбинации PCM / устройства.Возможность настройки, предлагаемая нашей платформой, дает возможность использовать эту платформу для любых ферментативных реакций. В-третьих, наш нагреватель может достигать заданной температуры за 1 минуту, что в 5-30 раз быстрее (8), чем современные химические нагреватели. Это сокращает время, необходимое для получения результатов. Например, для типичной 30-минутной реакции амплификации, которая в противном случае потребовала бы 10-минутного времени нарастания, использование миниатюрного нагревателя уменьшило бы общее время анализа примерно на 30%, что позволило бы сократить время цикла и ответа.Наконец, миниатюрные обогреватели недороги в использовании. Каждый нагреватель стоит около 7 центов за реакцию ( SI, приложение , таблица S3). Для 100 реакций это потребует материальных затрат ∼7 долларов США. С другой стороны, для обычных химических нагревателей сам PCM может стоить до 54 долларов США / кг (39) с повторяющимися расходами на реагенты для пополнения источника топлива. Наши миниатюрные обогреватели - это конкурентоспособная альтернатива для использования в условиях отсутствия электричества.

    Однако, чтобы быть полностью готовым к развертыванию в полевых условиях, необходимы дальнейшие улучшения миниатюрного нагревателя.Во-первых, побочные продукты реакции, как газообразный водород, так и гидроксид лития, могут вызывать беспокойство у неспециалистов. Для типичного нагревателя, содержащего от ~ 2 до 20 мг лития, производится от ~ 0,29 до ~ 2,9 мг газообразного водорода. Нижний предел взрываемости или минимальная концентрация газообразного водорода, необходимая для поддержания горения, составляет 4% по объему (40). При максимальной массе 2,9 мг и плотности 0,09 г / л это потребует, чтобы испытательное пространство было закрытым и меньше размера большой бутылки с водой (∼800 см 3 по объему), чтобы привести к взрыву. при наличии источника возгорания.Мы не предполагаем, что в хорошо вентилируемом помещении такое количество газообразного водорода, образующегося даже за несколько реакций, будет проблематичным. С другой стороны, для аналогичной массы лития производится от ~ 0,29 до 2,9 М гидроксида лития. При такой концентрации гидроксида лития раствор может достигать pH от 13 до 14, что является едким веществом в случае разлива. В будущих версиях миниатюрного нагревателя мы планируем реализовать возможность переноса нейтрализующего химического вещества, такого как аскорбиновая кислота, для обеспечения более безопасного обращения.Наконец, с точки зрения приложений, хотя мы показали полезность миниатюрных нагревателей для диагностических целей, мы могли бы использовать их для чего угодно, от приготовления пищи и кипячения воды до редактирования генов. Побочные продукты этой реакции могут быть использованы для других целей. Это может быть что угодно: от использования газообразного водорода в качестве двигателя для небольших реакций до обеспечения электричеством через топливные элементы на месте оказания медицинской помощи. В конечном итоге мы планируем обеспечить лучший доступ к передовым биохимическим методам, включая диагностику, за счет предоставления портативного и бесплатного обогрева в любом месте.

    Материалы и методы

    Разработка миниатюрных литиевых нагревателей.

    Всего 0,75 мм от 2 до 6 мм 2 звезд были созданы в Illustrator и перенесены в программу RetinaEngrave. Акриловые листы (3,175 мм) (McMaster-Carr) были вырезаны лазером (лазер полного спектра) с внутренней формой различной площади поверхности (от 0,75 мм 2 до 6 мм 2 ) с использованием программного обеспечения RetinaEngrave. Полученная площадь будет зависеть от производственного допуска.Затем, используя тот же метод, была вырезана внешняя круглая форма диаметром 9 мм. Он использовался в качестве акриловой формы, в которую сжимались литиевые проволоки (Sigma-Aldrich) с использованием ручного сжатия. В будущем мы планируем увеличить объем разработки за счет использования роторного таблеточного пресса для сжатия. Избыточный литий удаляли и один конец формы герметизировали дополнительным акриловым цилиндром диаметром 9 мм. Герметизация была выполнена с использованием ацетона для расплавления акриловой основы перед прикреплением к форме, заполненной литием.Акриловая основа и форма, заполненная литием, составляли простую версию миниатюрного нагревателя. Для разработки полной версии нагревателя акриловые листы 1,5875 мм (McMaster-Carr) были вырезаны лазером в форме колец с внутренним диаметром 7 мм и внешним диаметром 9 мм. Таким же способом запечатывания кольца были прикреплены к форме. Наконец, в кольцевую форму добавляли 10 мкл минерального масла (BioShop), различные количества SDS (Medstore) и маннита (Mannogem EZ, высушенный распылением маннит, SPI Pharma), в зависимости от предпочтительной скорости нагрева.

    Разработка каналов различной формы для обеспечения точности нагрева.

    Различные формы 3 мм 2 были вырезаны лазером, как описано ранее. Треугольник был равносторонним, а звезда состояла из пяти равнобедренных треугольников с острым углом на вершине 30 °. Акриловые каналы были заполнены литием и запломбированы внизу, как описано ранее. Для контроля температуры формы помещали вертикально в 1 мл воды, используя кювету объемом 4 мл (BioMart, каталог №112804). В кювету помещали 600 мкл Eppendorf с 50 мкл реакционного объема для нагрева. Затем использовали тепловизионную камеру (FLIR E60) для наблюдения за температурой реакционного объема в Eppendorf. Используя программное обеспечение FLIR Tools + , мы смогли измерить температуру раствора с течением времени. За движением пузырьков водорода по каналам следили с помощью видеокамеры.

    Разработка различных участков поверхности каналов для обеспечения диапазона температур (высокая скорость нагрева).

    Звезды с площадью поверхности 0,75 мм 2 , 1,5 мм 2 , 3 мм 2 и 6 мм 2 были вырезаны лазером и преобразованы в простую версию нагревателя, как описано ранее. Нагреватели помещали в 1 мл воды. Нагрев, обеспечиваемый нагревателями, контролировали с помощью тепловой камеры, помещая открытую пробирку Эппендорфа с 50 мкл воды. Результирующая температура каждого нагревателя рассчитывалась по зарегистрированной пиковой температуре. Продолжительность поддержания максимальной температуры определялась периодом времени, в течение которого температура находилась в пределах 5 ° C.

    Использование SDS для увеличения времени удержания.

    Звездообразные желобчатые формы размером 3 мм 2 были заполнены литием и герметизированы с одного конца с помощью другой акриловой формы. Были приготовлены трехмиллиметровые растворы 0%, 0,5%, 1% и 2% SDS с 5% силиконовым пеногасителем (Sigma-Aldrich, номер партии BCBZ4425). Растворы сначала нагревали на водяной бане до 55 ° C, после чего миниатюрные нагреватели опускались в раствор. Температуру с течением времени контролировали, помещая в пробирку для ПЦР 50 мкл воды.

    Разработка различных участков поверхности каналов для обеспечения диапазона температур (низкая скорость нагрева).

    Разработаны нагреватели в простом исполнении с каналами звездообразной формы с площадью поверхности 0,75, 1,5, 3 и 6 мм 2 . Были приготовлены кюветы с 3 мл 1% SDS и 10% кремнийорганического пеногасителя (количество добавленного пеногасителя варьировалось в зависимости от эффективности партии). Температуру кювет увеличивали до 44 ° C, 49 ° C, 55 ° C или 59 ° C соответственно (с использованием водяной бани) для каждой соответствующей площади поверхности.При повышенной температуре нагреватели помещали в кюветы и контролировали температуру (пробирки для ПЦР с 50 мкл воды) с помощью тепловизионной камеры. Пиковые температуры определялись как максимальная температура, достигаемая каждым нагревателем. Продолжительность рассчитывалась путем определения периода времени, в течение которого заданная температура поддерживалась в пределах 5 ° C.

    Разработка каналов с большей глубиной для продления времени удержания.

    1,5-мм формы 2 звездообразные с каналом глубиной 3.175 мм были разработаны в простые нагреватели. Для разработки простого нагревателя глубиной 9,525 три отдельных формы в форме звезды размером 1,5 мм 2 были сначала заполнены литием. Три формы были оплавлены с одного конца ацетоном и закреплены друг на друге, подобно зданию, сделанному из строительных блоков и запечатанному с одного конца. Мониторинг и измерение температуры и продолжительности выполнялись, как описано ранее.

    Исследование влагостойкости.

    Миниатюрные нагреватели с (контрольным) минеральным маслом и маннитом и без них были разработаны и хранятся при относительной влажности 20% или 70%.Разработаны управляющие и миниатюрные нагреватели путем лазерной резки 1,5 мм 2 звездообразных каналов из акриловых листов толщиной 3,175 мм. Затем эти формы были заполнены литием. Цилиндрические формы, используемые для нижнего уплотнения, были вырезаны лазером с использованием акриловых листов диаметром 3,175 мм и диаметром 8 мм. Кольцевые формы, которые должны были быть закреплены наверху, были вырезаны лазером из акриловых листов толщиной 1,5875 мм, с внешним диаметром 8 мм и внутренним диаметром 6 мм. Кольцеобразные формы и формы, заполненные литием, выдерживали в ацетоне в течение 20 минут, в то время как формы с нижним уплотнением выдерживали в ацетоне в течение 40 минут.Контроллер, а также миниатюрные нагреватели были разработаны путем соединения вместе нижнего уплотнения, литиевой формы и кольцевой формы. В миниатюрный нагреватель (в отличие от контроля) добавляли 10 мкл минерального масла и доливали маннит. Для проверки конечной температуры раствора контроли, а также миниатюрный нагреватель помещали в 1 мл 0,05% SDS и 10% кремнийорганического пеногасителя. Пиковую температуру контролировали каждую неделю в течение 4 недель с помощью пробирки Эппендорфа с 50 мкл воды.

    Использование нагревателей для переноса SDS / маннита.

    1,5 мм 2 звезд с внешним диаметром 9 мм были вырезаны лазером с использованием акрилового листа 3,175 мм. Нижнее уплотнение (акриловый лист 3,175 мм) было вырезано лазером, чтобы иметь диаметр 9 мм, в то время как кольцевая форма (акриловый лист 1,5875 мм) имела внешний диаметр 9 мм и внутренний диаметр 7 мм. Три компонента были скреплены вместе с использованием ацетона (на нижнем уплотнении и кольцевых формах), чтобы слегка расплавить акрил. К этой конструкции было добавлено 10 мкл минерального масла. Для трех повторов добавляли 30 мг SDS (1% SDS), а для другого набора из трех повторов - 0.Добавляли 5 мг SDS и 29,5 мг маннита (0,05% SDS). Мониторинг и измерение температуры и продолжительности выполнялись, как описано ранее.

    Испытание на моделирование разлива.

    Канал в форме звезды 2 диаметром 1,5 мм с внешним диаметром 9 мм был вырезан лазером и преобразован в полную версию миниатюрного нагревателя, как описано ранее. Заполненные и пустые варианты канала сравнивали, чтобы определить количество лития, содержащегося в каждом нагревателе. Эквивалентное количество лития, 5.63 ± 0,21 мг, взвешивали и помещали рядом с нагревателем на предметное стекло. Всего было отмерено 500 мкл воды, которые вылили на предметное стекло во время записи с помощью тепловизора. Температурный профиль пиковых температур, достигнутых литием и миниатюрным нагревателем, контролировался в течение 10-минутного периода времени.

    Размножение фагов Т4.

    Всего 10 мл 20 г / л LB инокулировали Escherichia coli (ATCC, каталожный № 11303) и культивировали в течение ночи при 37 ° C.Всего в чашки Петри добавляли 20 мл 1,5% агара в LB и давали ему затвердеть. Всего было добавлено 10 мкл фагов Т4 (АТСС) и смешано с 200 мкл культивированного E. coli . Эту смесь добавляли к 5 мл 0,5% агара в LB. Смесь фаг / бактерии / агар добавляли в чашки Петри с 1,5% агаром и оставляли на ночь при 37 ° C для размножения. После инкубации в течение ночи мягкий агар соскребали и добавляли в 30 мл LB. Твердый дебрис центрифугировали при 1000 × г в течение 25 минут и надосадочную жидкость с колониями фага Т4 (фильтровали с 0.22 мкм фильтр).

    Центрифугирование фагов Т4.

    Чтобы удалить свободно плавающую ДНК из образцов фага Т4, образцы центрифугировали при 20000 × г в течение 90 мин. Затем супернатант удаляли и осадок ресуспендировали в эквивалентных объемах 50 мМ Трис и 10 мМ MgCl 2 при pH 7,5. Раствор оставляли на ночь при 4 ° C для ресуспендирования без интенсивного перемешивания.

    Лизис фагов Т4.

    6-мм звездообразные каналы 2 были вырезаны лазером и преобразованы в полную версию нагревателя. К окончательному дизайну добавляли 10 мкл минерального масла, 0,5 мг SDS и 29,5 мг маннита. Фаги Т4 разбавляли 1: 100 в 50 мМ Трис и 10 мМ MgCl 2 при pH 7,5. Три повтора по 80 мкл разбавленных фагов помещали в кювету с 1 мл воды вместе с проявленным нагревателем и 10% силиконовым пеногасителем. Контроли обрабатывали бок о бок, где 80 мкл разбавленных фагов Т4 лизировали при 95 ° C в течение 1 мин с использованием термоциклера.Количество лизированной ДНК качественно измеряли путем смешивания 10 мкл лизированной пробы с 190 мкл 1 × SYBR Gold. Флуоресценцию измеряли с помощью планшет-ридера (Tecan Life Sciences).

    Подготовка проб RPA.

    Для каждой реплики был приготовлен следующий премикс (объемы для единичных повторов): 2,4 мкл 10 мкМ прямого праймера (5 'TGATTTACAAGAATTGCGAATGGTGCTTGTTCATC 3'), 2,4 мкл 10 мкМ обратного праймера (5 'AGTGGAAACTGAGACGATA' Integrated ДНК-технологии), 9.2 мкл воды, 29,5 мкл буфера для регидратации и 2,5 мкл 280 мМ MgAc (Abbott Laboratories). К 46 мкл премикса добавляли осадок RPA вместе с 40 мкл воды (отрицательный контроль) или 40 мкл неочищенной лизированной ДНК Т4.

    RPA лизированных фагов T4 с использованием миниатюрных нагревателей.

    Для работы RPA при 42 ° C были разработаны нагреватели в форме звезды 4 мм 2 (до 50 ° C) и 1,5 мм 2 (выдерживает 42 ° C). В 4-мм нагреватель 2 добавляли 1,5 мг SDS и 28,5 мг маннита.В 1,5-мм нагреватель 2 добавляли 30 мг SDS. Нагреватели были помещены в 3 мл воды (сначала 4 мм 2 , затем 1,5 мм нагреватель 2 ) и 10% силиконовый пеногаситель. Пробирки для ПЦР с реакционной смесью RPA (либо отрицательной по ДНК, либо с неочищенной лизированной ДНК Т4) помещали в кювету. Реакции RPA давали возможность протекать в течение 10 мин. Амплифицированные продукты визуализировали с использованием 3% агарозного геля и визуализировали с помощью красителя Green-DNA (BioBasic) и гелевого сканера (Gel Doc EZ Gel).

    Флуоресцентный анализ.

    Подготовка образца к денатурации.

    К 50 мкл амплифицированного продукта (как отрицательный контроль, так и образец) добавляли 0,6 мкл 10 мкМ экзо-зонда. Мы использовали следующую последовательность для экзо-зонда: 5'TCAAGCAGTAATTCGTTT (dT-6FAM) (dSpacer) (dT-BHQ1) TCCGTCTAAAAAT3 '(BioBasic).

    Шаг денатурации.

    Звездообразные формы размером 6 мм 2 были разработаны в миниатюрные нагреватели. В нагреватели добавляли 0,5 мг SDS и 29,5 мг маннита.Нагреватели помещали в 1 мл воды и 10% кремнийорганического пеногасителя, чтобы довести температуру раствора до 95 ° C. Образцы в пробирках для ПЦР с экзозондами помещали в кювету и позволяли денатурировать их менее чем на 1 мин. Зондам позволяли денатурировать менее 1 мин. Затем зондам давали возможность гибридизоваться с амплифицированным продуктом, оставляя реакционную трубку при комнатной температуре на 10 мин.

    Подготовка образца к расщеплению экзонуклеазой III.

    К продукту ДНК, амплифицированному зондом, 5 мкл 10-кратного реакционного буфера экзонуклеазы III, а также 0.Добавляли 5 мкл 200 Ед / мкл экзонуклеазы II (Thermo Fisher Scientific).

    Расщепление экзонуклеазой III.

    Для проведения флуоресцентного анализа при 42 ° C был разработан нагреватель с 4-миллиметровым звездообразным каналом 2 и 1,5-мм звездообразным каналом 2 . К 4-мм нагревателю 2 добавляли 1,5 мг SDS и 28,5 мг маннита; в то время как 1,5-мм нагреватель 2 содержал 30 мг SDS. Нагреватель 2 диаметром 4 мм сначала был помещен в 3 мл воды и 10% пеногасителя.Литию давали полностью израсходоваться, после чего 1,5-мм нагреватель 2 помещали в раствор для поддержания температуры 42 ° C. В кювету помещали пробирки для ПЦР с продуктами амплификации, зондами и экзонуклеазой III в раствор. Реакции давали возможность протекать в течение 10 мин.

    Обнаружение флуоресценции с помощью смартфона.

    Держатель для iPhone SE был напечатан в трехмерном (3D) формате для размещения эмиссионного фильтра 536/40. Фонарь 465 нм (Joyland; арт.CSK68B) с фильтром возбуждения 480/40. Держатель телефона и фонарик фиксировали относительно друг друга и образца с помощью ретортной стойки. Изображения были получены с использованием приложения NightCap Международной организации по стандартизации (ISO), измеряющего чувствительность сенсора в 4000 единиц и экспозицию 10 с при выдержке 1/2 с на кадр.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *